Maklumat

Bolehkah Pfx polymerase menambah hanya satu 3' A yang tidak terjual?

Bolehkah Pfx polymerase menambah hanya satu 3' A yang tidak terjual?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Saya cuba mengklon produk PCR yang telah dikuatkan menggunakan polimerase Pfx ke dalam vektor pGemT. Saya terpaksa A-tail produk PCR menggunakan Taq polymerase kerana Pfx hanya menghasilkan produk akhir tumpul. Reaksi pengikatan saya berjaya, namun apabila saya mendapat jujukan, terdapat T tambahan antara 3'hujung-T pGem dan kodon permulaan produk saya. Ia hanya berlaku pada hujung 3' pGemT (atau hujung 5' produk saya). Bolehkah polimerase Pfx menjana produk PCR dengan hanya satu terjual 3'hujung? atau Bolehkah Taq polymerase menambah dua dATP berturut-turut semasa A-tailing?

Sila tulis saya fikiran anda secepat mungkin, ia telah berlaku dua kali dan ia sudah menyakitkan :(

GGC CGC GGG A-T-T-T-G ATG GGA AGC ATG AAG

Dua T dalam Bold adalah milik pGemT, T Italic ialah T tambahan yang saya dapat daripada tindak balas penjujukan. Selepas T dalam Italic anda mungkin dapati 5'hujung sisipan saya. T kedua (dalam huruf tebal) daripada pGemT ialah yang diikat dengan A tidak terjual ditambah melalui protokol A-tailing.


Polimerase DNA

A polimerase DNA ialah ahli keluarga enzim yang memangkinkan sintesis molekul DNA daripada nukleosida trifosfat, prekursor molekul DNA. Enzim ini penting untuk replikasi DNA dan biasanya bekerja dalam kumpulan untuk mencipta dua dupleks DNA yang sama daripada dupleks DNA asal tunggal. Semasa proses ini, polimerase DNA "membaca" helai DNA sedia ada untuk mencipta dua helai baru yang sepadan dengan helai sedia ada. [1] [2] [3] [4] [5] [6] Enzim ini memangkinkan tindak balas kimia

Polimerase DNA menambah nukleotida kepada tiga hujung (3') perdana seutas DNA, satu nukleotida pada satu masa. Setiap kali sel membahagi, polimerase DNA diperlukan untuk menduplikasi DNA sel, supaya salinan molekul DNA asal boleh dihantar ke setiap sel anak. Dengan cara ini, maklumat genetik diturunkan dari generasi ke generasi.

Sebelum replikasi boleh berlaku, enzim yang dipanggil helikase melepaskan molekul DNA daripada bentuk tenunan ketat, dalam proses memecahkan ikatan hidrogen antara bes nukleotida. Ini membuka atau "membuka zip" DNA untai dua untuk memberikan dua untai tunggal DNA yang boleh digunakan sebagai templat untuk replikasi dalam tindak balas di atas.


Bolehkah Pfx polymerase menambah hanya satu 3' A yang tidak terjual? - Biologi

Reaksi Rantaian Polimerase (PCR) boleh digunakan untuk menjana serpihan DNA dengan pantas untuk pengklonan, dengan syarat sumber DNA templat yang sesuai wujud dan maklumat jujukan yang mencukupi diketahui untuk membenarkan reka bentuk primer khusus untuk amplikon yang dikehendaki. Tidak seperti pengklonan tradisional, PCR menawarkan keupayaan untuk mengklon serpihan DNA yang mungkin rendah dalam sampel kompleks seperti DNA genomik, atau cDNA yang sepadan dengan transkrip mRNA yang jarang ditemui. Produk PCR boleh dihadam dan diikat dengan cara tradisional, diikat terus (tumpul atau hujung TA), atau digunakan dalam pengklonan bebas ligation (LIC) atau aplikasi pengklonan lancar, seperti Gibson Assembly ® atau NEBuilder HIFI DNA Assembly (NEBuilderHiFi.com).

Semasa PCR biasa, DNA templat (mengandungi kawasan yang menarik) dicampur dengan deoxynucleotides (dNTPs), polimerase DNA dan primer. Primer ialah segmen pendek DNA pelengkap yang berpasangan asas dengan DNA templat, hulu kawasan yang diminati, dan berfungsi sebagai tapak pengambilan untuk polimerase. PCR melibatkan satu siri kitaran suhu yang dikawal secara automatik dengan menggunakan mesin termos yang mengawal kedua-dua suhu tindak balas dan tempoh setiap langkah suhu dengan tepat, memastikan penguatan yang cekap (untuk butiran lanjut tentang PCR, lihat Penguatan DNA).

Untuk tindak balas PCR rutin dan mantap SatuTaq DNA Polimerase adalah pilihan enzim yang paling biasa. Polimerase ini kebanyakannya meninggalkan adenin tunggal bebas templat (A) pada hujung 3&rsquo produk PCR. Untuk PCR kesetiaan tinggi, polimerase DNA pembacaan pruf harus digunakan. Enzim sebegini tidak menghasilkan satu tapak terjuntai, meninggalkan termini tumpul. Pertimbangan tentang hujung produk PCR, termasuk status fosforilasi mereka, adalah penting untuk strategi pengklonan seterusnya (lihat Pengubahsuaian Akhir). Apabila primer PCR termasuk tapak enzim sekatan, produk PCR boleh dihadam dan diikat dengan cara tradisional.

Molekul vektor untuk pengklonan juga boleh dihasilkan oleh PCR. Tapak sekatan yang termasuk dalam buku asas membenarkan penjanaan hujung melekit (lembaran untaian tunggal) untuk memudahkan pengklonan serpihan sekatan. Jika tidak, vektor hujung tumpul boleh dihasilkan oleh PCR menggunakan polimerase pembacaan pruf ketelitian tinggi atau dengan menumpulkan asas tunggal 3&rsquo tidak terjual yang dihasilkan oleh Taq polimerase. Transkripsi terbalik RNA kepada DNA pelengkap untai pertama (cDNA) diikuti oleh PCR (RT-PCR) membolehkan pengklonan molekul DNA untai dua yang sepadan dengan transkrip gen (untuk mRNA, lihat sintesis cDNA).

Pilih Jenis:

Artikel Ciri

Baca tentang hubungan antara struktur dan fungsi Polimerase semasa menyalin DNA.


KEPUTUSAN

Pengikatan hujung-ke-hujung DNA beruntai tunggal menggunakan T4 Ligase DNA

Untuk meneroka kecekapan pengikatan hujung-ke-hujung terbelah bagi DNA untai tunggal dengan T4 Ligase DNA dengan ketiadaan struktur pin rambut, kami mereka bentuk skema pengikatan di mana oligonukleotida serpihan dihibridkan kepada penyesuai terbiotinilasi oligonukleotida (penderma), yang membolehkan imobilisasi seterusnya produk pengikatan pada manik dan penyingkiran serpihan dengan rawatan haba ringan .

Kami mula-mula menentukan kecekapan tindak balas ligation menggunakan kumpulan oligonukleotida 60 nt dengan urutan rawak ('60N') sebagai penerima, yang serupa dengan situasi dalam penyediaan perpustakaan di mana DNA input terdiri daripada helai urutan yang tidak diketahui. Di bawah keadaan yang optimum, T4 Ligase DNA hampir bertukar sepenuhnya 1 pmol (~ 6 × 10 11 molekul) kumpulan 60N kepada produk pengikatan. Kecekapan yang luar biasa juga diperhatikan dengan jumlah input 60N yang lebih tinggi. Malah, kecekapan ligation adalah lebih tinggi daripada yang dicapai dengan CircLigase (Rajah 2). Kami memperoleh keputusan yang sama apabila menggunakan jujukan penyesuai/serpihan lain yang direka secara rawak (Tambahan Rajah S1), menggariskan keteguhan pendekatan. Kecekapan ligasi berkurangan hanya apabila molekul penerima bagi urutan yang ditentukan digunakan dan bukannya kumpulan oligonukleotida, seperti yang dijangkakan disebabkan oleh ketersediaan serpihan yang terhad dengan pelengkap jujukan yang mencukupi kepada penerima (Tambahan Rajah S2).

Kaedah ringkas penyediaan perpustakaan untaian tunggal

Untuk menilai sama ada pengikatan bertali tunggal terbirat dengan T4 Ligase DNA boleh menggantikan CircLigase dalam penyediaan perpustakaan untaian tunggal, kami mencipta perpustakaan dengan kedua-dua strategi pengikatan menggunakan ekstrak DNA beruang gua berusia >50 000 tahun. Adalah penting untuk ambil perhatian bahawa CircLigase menunjukkan aktiviti optimum sekitar 60°C ( 14) manakala pengikatan DNA untai tunggal terbelah dengan T4 Ligase DNA dijalankan pada suhu yang lebih rendah (37°C). Memandangkan suhu yang dikurangkan secara teorinya boleh menggalakkan interaksi antara helai DNA yang mungkin mengganggu pengikatan, kami menyediakan perpustakaan daripada empat volum berbeza (1, 3, 9 dan 27 μl) ekstrak DNA untuk menentukan kepekaan tindak balas kepada kepekatan DNA input yang berbeza-beza.

Berdasarkan kuantifikasi perpustakaan oleh PCR kuantitatif dan penjujukan pada sistem MiSeq Illumina, kami mengira kandungan jujukan bermaklumat dalam setiap perpustakaan (Jadual Tambahan S3), iaitu jumlah nukleotida yang terdiri dalam jujukan seperti beruang dengan panjang 35 atau lebih. Langkah ini tidak menghiraukan molekul yang terlalu pendek untuk pasti dipetakan ke genom rujukan dan mengimbangi kandungan maklumat yang lebih rendah dalam urutan pendek. Untuk jumlah ekstrak yang kecil, kami memerhatikan hubungan input/output linear yang dijangkakan dengan kedua-dua kaedah (Rajah 3A). Walau bagaimanapun, menariknya, kami melihat penurunan dalam hasil perpustakaan dengan volum input tertinggi ekstrak (9 dan 27 μl) untuk CircLigase tetapi tidak T4 Perpustakaan ligase DNA. Pustaka CircLigase dengan volum input yang lebih tinggi juga dipengaruhi oleh bias lain, termasuk saiz sisipan yang lebih panjang, kandungan GC yang lebih rendah dan frekuensi penggantian C hingga T yang lebih tinggi pada hujung 3΄nya (Rajah 3B– D) daripada yang dihasilkan oleh T4 Ligase DNA. Asimetri yang ketara dalam penggantian C kepada T, yang terhasil daripada deaminasi sitosin kepada urasil dalam DNA purba (30), menunjukkan pengikatan 3΄ sitosin yang kurang cekap berbanding timin oleh CircLigase dengan kehadiran DNA berkepekatan tinggi. Kecondongan ini mungkin disebabkan oleh ketepuan tindak balas CircLigase dengan DNA (31) atau kepekaan yang lebih rendah daripada skema pengikatan splinted terhadap bahan perencatan yang diekstrak bersama daripada tulang.

Kesan skim ikatan bertali tunggal pada ciri perpustakaan. (A) Kandungan urutan bermaklumat perpustakaan yang disediakan dengan CircLigase dan T4 Ligase DNA sebagai fungsi isipadu input ekstrak DNA purba yang digunakan untuk penyediaan perpustakaan. (B) Purata kandungan GC bagi jujukan yang diperoleh dengan dua skema ligation. Ambil perhatian bahawa kandungan GC purata melebihi genom mamalia biasa kerana kebanyakan jujukan berasal daripada DNA mikrob, yang merupakan sumber dominan DNA dalam kebanyakan tulang purba. (C) Taburan saiz serpihan dalam perpustakaan seperti yang disimpulkan daripada bacaan berpasangan yang digabungkan bertindih. Artifak pendek di perpustakaan yang disediakan daripada DNA input yang sangat sedikit (bersamaan dengan ~1 mg tulang) adalah disebabkan terutamanya oleh penggabungan serpihan serpihan. (D) Kekerapan penggantian C kepada T akibat kerosakan berhampiran hujung jujukan 5΄ dan 3΄.

Kesan skim ikatan bertali tunggal pada ciri perpustakaan. (A) Kandungan urutan bermaklumat perpustakaan yang disediakan dengan CircLigase dan T4 Ligase DNA sebagai fungsi isipadu input ekstrak DNA purba yang digunakan untuk penyediaan perpustakaan. (B) Purata kandungan GC bagi jujukan yang diperoleh dengan dua skema ligation. Ambil perhatian bahawa kandungan GC purata melebihi genom mamalia biasa kerana kebanyakan jujukan berasal daripada DNA mikrob, yang merupakan sumber dominan DNA dalam kebanyakan tulang purba. (C) Taburan saiz serpihan dalam perpustakaan seperti yang disimpulkan daripada bacaan berpasangan yang digabungkan bertindih. Artifak pendek di perpustakaan yang disediakan daripada DNA input yang sangat sedikit (bersamaan dengan ~1 mg tulang) adalah disebabkan terutamanya oleh penggabungan serpihan serpihan. (D) Kekerapan penggantian C kepada T akibat kerosakan berhampiran hujung jujukan 5΄ dan 3΄.

Satu lagi langkah dalam penyediaan perpustakaan untai tunggal yang berpotensi untuk penambahbaikan ialah sintesis untai kedua, yang dilakukan menggunakan Bst polimerase dalam protokol asal, dengan itu memerlukan pembaikan hujung tumpul berikutnya untuk mengeluarkan nukleotida yang ditambahkan oleh aktiviti pemindahan terminal enzim. Kerana adalah wajar untuk melakukan kedua-dua tindak balas dalam satu langkah, kami menghasilkan perpustakaan tambahan daripada dua ekstrak DNA purba serta kawalan oligonukleotida menggunakan Bst polimerase dan dua enzim pembacaan bukti: T4 DNA polimerase dan serpihan Klenow daripada E coli DNA polimerase I. Enzim terakhir telah digunakan dalam penyediaan perpustakaan untai tunggal baru-baru ini (22), tetapi tanpa membentangkan data yang membandingkan prestasinya dengan Bst polimerase. Di samping itu, kami termasuk Sulfolobus DNA polimerase IV (Dpo4) dalam eksperimen. Sama seperti Bst polimerase, Dpo4 tidak mempunyai aktiviti eksonuklease 3΄-5΄ tetapi menggabungkan nukleotida merentasi pelbagai lesi DNA dan dengan itu mungkin sangat cekap dalam menyalin molekul DNA purba yang sangat rosak (32). Untuk mengelakkan degradasi eksonukleolitik kami memperkenalkan tiga kaitan PTO ke dalam terminal 3΄ primer sambungan untuk kegunaannya dengan T4 DNA polimerase dan serpihan Klenow. Hasil molekul perpustakaan berbeza-beza agak sedikit di antara polimerase, dengan keuntungan molekul yang lebih tinggi sedikit dalam perpustakaan yang disediakan dengan polimerase yang tidak mempunyai aktiviti exonuclease 3΄-5΄ (Bst polimerase dan Dpo4) ( Rajah Tambahan S3a dan Jadual Tambahan S3 ). Penyiasatan penjajaran jujukan mendedahkan tiada frekuensi penggantian yang tinggi selain daripada C ke T, termasuk dalam perpustakaan yang disediakan dengan Dpo4. Oleh itu, kami tidak mengesan sebarang isyarat yang akan mencadangkan kehadiran jenis kerosakan yang tidak dapat dikesan sebelum ini dalam DNA purba yang mungkin membawa kepada penggabungan nukleotida palsu disebabkan oleh keupayaan pintasan lesi enzim ini. Walau bagaimanapun, kami mengesan perbezaan besar dalam frekuensi penggantian C hingga T berhampiran hujung 5΄ penjajaran jujukan, terutamanya dengan T4 Polimerase DNA, yang membawa kepada kekurangan penggantian C kepada T yang ketara antara kedudukan penjajaran kedua dan lebih kurang kesepuluh. Ini menunjukkan bahawa enzim yang terakhir kurang cekap dalam menggabungkan nukleotida merentasi urasil yang terletak berhampiran dengan hujung 5΄ helai templat (Tambahan Rajah S3b). Memandangkan pilihan polimerase hanya memberi kesan kecil pada hasil perpustakaan, kami memilih untuk menggantikannya Bst polimerase dengan serpihan Klenow untuk menghapuskan satu langkah tindak balas daripada protokol.

Perbandingan kaedah penyediaan perpustakaan pada DNA terdegradasi

Untuk membandingkan prestasi ssDNA2.0 dengan penyediaan perpustakaan berasaskan CircLigase, kami menyediakan perpustakaan DNA daripada pelbagai sumber: beberapa tulang purba, tisu yang disimpan dalam formalin selama 5 hingga 11 tahun, mengedarkan DNA bebas sel dan DNA genomik yang dicukur. Di samping itu, kami memasukkan dalam perbandingan ini dua kaedah terkandas dua yang paling biasa digunakan dalam kajian terdahulu DNA purba. Yang pertama ialah kaedah yang pada asalnya dibangunkan untuk penjujukan DNA berkualiti tinggi oleh 454 Sains Hayat (33) dan kemudiannya disesuaikan untuk kegunaan dengan DNA yang sangat terdegradasi (23, 24). Ia adalah berdasarkan pengikatan campuran penyesuai kepada serpihan DNA purba yang dibaiki dengan hujung tumpul T4 Ligase DNA (Rajah 1C). Walaupun separuh daripada molekul dibiarkan dengan penyesuai yang sama dan oleh itu tidak boleh diakses untuk amplifikasi dan penjujukan hiliran, kaedah ini teguh, agak murah dan dengan itu digunakan secara meluas dalam kajian DNA purba, terutamanya yang melibatkan bilangan sampel yang besar (34, 35). ). Kaedah double-stranded kedua pada asalnya dicadangkan oleh Illumina (36) dan bergantung pada pengikatan T/A-tergantung penyesuai seperti garpu, atau, dalam pelaksanaan NEBNext Ultra II DNA Library Prep Kit New England Biolabs untuk Illumina yang digunakan di sini, penyesuai berbentuk loceng (Rajah 1D). Kaedah Illumina membolehkan pengikatan arah dan tahap penyederhanaan yang lebih tinggi, cth. dengan menggabungkan beberapa atau semua tindak balas tanpa langkah penulenan terputus-putus. Ia digunakan secara meluas untuk penyediaan perpustakaan daripada DNA berkualiti tinggi, tetapi mewakili pilihan yang kurang ideal untuk DNA yang sangat terdegradasi, kerana ia memerlukan penulenan selektif saiz untuk mengeluarkan dimer penyesuai. Kaedah ini juga menanggung risiko pembentukan artifak chimeric apabila digunakan dengan serpihan DNA pendek (37).

Kandungan nukleotida bermaklumat adalah serupa dalam perpustakaan yang disediakan dengan ssDNA2.0 dan kaedah berasaskan CircLigase untuk semua sampel (Rajah 4). Kedua-dua kaedah secara konsisten mengatasi kaedah terkandas berganda terbaik apabila digunakan dengan DNA yang sangat terdegradasi. Dengan ssDNA2.0, hasil jujukan bermaklumat adalah 11.6 kali lebih tinggi secara purata untuk ekstrak DNA purba dan 1.4 kali ganda untuk DNA bebas sel. Selaras dengan laporan terdahulu (9, 10), penyediaan perpustakaan terkandas tunggal juga meningkatkan perkadaran jujukan dipetakan dalam perpustakaan DNA purba (Supplementary Figure S5), sekali gus mengurangkan beban pencemaran mikrob dalam penjujukan. Secara mengejutkan, hasil perpustakaan daripada DNA tetap formalin adalah ~ 150- hingga ~ 3100 kali ganda lebih tinggi dengan penyediaan perpustakaan untai tunggal, membolehkan penjujukan genom liputan berbilang kali ganda daripada ekstrak yang sebaliknya tidak menghasilkan maklumat jujukan. Hasil perpustakaan daripada sampel DNA yang terdegradasi adalah paling rendah dengan kaedah Illumina, yang sekurang-kurangnya sebahagiannya disebabkan oleh kehilangan molekul pendek (lihat Rajah Tambahan S4 untuk taburan panjang jujukan). Perlu juga diperhatikan bahawa pelaksanaan khusus penyediaan perpustakaan jenis Illumina yang digunakan di sini mengurangkan hasil perpustakaan daripada DNA purba disebabkan oleh rawatan uracil-DNA-glycosylase, yang menghalang penguatan helai DNA yang mengandungi urasil, kira-kira separuh daripadanya berterusan melalui tumpul- tamatkan langkah pembaikan ( 30).

Prestasi kaedah penyediaan perpustakaan tunggal dan dua untai menggunakan DNA daripada sumber yang berbeza. Kandungan jujukan bermaklumat setiap perpustakaan disediakan dalam peratus daripada yang diperoleh dengan kaedah berprestasi terbaik untuk setiap sampel. Di samping itu, bilangan genom nuklear yang terdapat dalam setiap perpustakaan dikira dengan membahagikan kandungan jujukan bermaklumat dengan saiz genom rujukan yang digunakan untuk pemetaan.

Prestasi kaedah penyediaan perpustakaan tunggal dan dua untai menggunakan DNA daripada sumber yang berbeza. Kandungan jujukan bermaklumat setiap perpustakaan disediakan dalam peratus daripada yang diperoleh dengan kaedah berprestasi terbaik untuk setiap sampel. Di samping itu, bilangan genom nuklear yang terdapat dalam setiap perpustakaan dikira dengan membahagikan kandungan jujukan bermaklumat dengan saiz genom rujukan yang digunakan untuk pemetaan.

Semua kaedah penyediaan perpustakaan menghasilkan sejumlah besar molekul perpustakaan walaupun tanpa DNA input (Jadual Tambahan S3). Artifak ini disebabkan terutamanya oleh penggabungan oligonukleotida penyesuai yang tidak disintesis dengan sempurna ke dalam perpustakaan. ssDNA2.0 lebih terdedah kepada pembentukan artifak daripada penyediaan perpustakaan berasaskan CircLigase kerana ia menggunakan oligonukleotida tambahan untuk mengantara ligation beruntai tunggal. Dengan menukar pengubahsuaian menyekat oligonukleotida serpihan dalam perjalanan eksperimen kami, kami dapat mengurangkan pembentukan artifak dalam penyediaan perpustakaan secara berturut-turut kepada ~ 4 × 10 7 molekul (Jadual Tambahan S3). Nombor ini lebih tinggi sedikit daripada molekul ∼2 × 10 7 yang diperoleh dengan penyediaan perpustakaan berasaskan CircLigase dan artifak ∼1 × 10 7 dan ∼3 × 10 7 yang dijana dengan dua kaedah terkandas dua, tetapi lebih rendah daripada ∼1 × 10 8 molekul yang dilaporkan sebelum ini untuk kaedah CircLigase (4), menunjukkan bahawa bukan sahaja struktur kimia oligonukleotida tetapi juga variasi batch-to-batch dalam sintesis oligonukleotida menyumbang kepada pembentukan artifak. Memandangkan lebih banyak molekul perpustakaan diperoleh daripada jumlah sampel DNA yang sama dengan penyediaan perpustakaan untai tunggal, artifak hadir dalam perkadaran yang lebih rendah dalam perpustakaan ini (Jadual Tambahan S3), seterusnya menyerlahkan kesesuaian penyediaan perpustakaan untai tunggal untuk kerja dengan kecil. kuantiti DNA yang sangat terdegradasi.

Untuk perpustakaan DNA purba, kami memerhatikan frekuensi penggantian C hingga T yang disebabkan oleh deaminasi secara konsisten lebih rendah pada hujung 3΄ dalam ssDNA2.0 berbanding dengan perpustakaan CircLigase (Rajah Tambahan S6). Walaupun isyarat ini sebahagiannya mungkin disebabkan oleh pengikatan keutamaan urasil oleh CircLigase seperti yang diterangkan di atas, kami juga memerhatikan kurang representasi timin dalam enam kedudukan terakhir jujukan ssDNA2.0 (Tambahan Rajah S7), sepadan dengan panjang tepat tapak hibridisasi bagi serpihan oligonukleotida. Isyarat ini menunjukkan bahawa untaian DNA dengan hujung 3΄ yang kaya dengan timin—dan mungkin juga yang mempunyai hujung yang kaya dengan urasil—kurang cekap dicantumkan dengan pengikatan splinted. Untuk menyiasat sama ada panjang jujukan yang merosot tidak terhantuk serpihan oligonukleotida menyumbang kepada bias ligation, kami menyediakan perpustakaan tambahan daripada salah satu ekstrak DNA purba menggunakan serpihan dengan tujuh dan lapan asas degenerasi. Walaupun hasil keseluruhan molekul perpustakaan adalah serupa dengan tiga serpihan (Tambahan Rajah S8a), kami mendapati bahawa serpihan yang lebih panjang meningkatkan kedua-dua kandungan timin (Tambahan Rajah S7) serta kekerapan penggantian C kepada T pada hujung 3΄ jujukan (Supplementary Figure S8b), menunjukkan bahawa serpihan yang lebih panjang mengurangkan bias ligation yang dikaitkan dengan ligation DNA splinted.


Jenis Enzim yang Terlibat dalam Sintesis dan Pengklonan DNA: 7 Jenis

Tujuh jenis enzim tersebut ialah: (1) Alkali Fosfatase (2) Terminal Transferase (3) Termo-stabil DNA Polimerase (4) Bacteriophage RNA Polimerase (5) Nuklease: DNase dan RNase (6) Polinukleotida Kinase dan (7) DNA Ligase .

Jenis # A. Fosfatase Beralkali:

Fosfatase alkali mengeluarkan 5′ kumpulan fosfat daripada DNA dan RNA (Rajah 13.4). Ia juga akan mengeluarkan fosfat daripada nukleotida dan protein. Enzim ini paling aktif pada pH alkali oleh itu dikenali sebagai alkali fosfatase.

Terdapat beberapa sumber fosfatase beralkali yang berbeza dengan cara mudahnya ia boleh di-diaktifkan:

1. Bakteria alkali fosfatase (BAP) adalah enzim yang paling aktif, tetapi juga paling sukar untuk dimusnahkan pada penghujung tindak balas penyahfosforilasi.

2. Fosfatase alkali usus anak lembu (CIP) disucikan daripada usus lembu. Ini adalah fosfatase yang paling banyak digunakan dalam makmal biologi molekul kerana, walaupun kurang aktif daripada BAP, ia boleh dimusnahkan dengan berkesan oleh pencernaan protease atau haba (75 °C selama 10 minit dengan kehadiran 5 mM EDTA).

3. Udang alkali fosfatase diperoleh daripada udang air sejuk dan dipromosikan kerana mudah dimusnahkan oleh haba (65°C selama 15 minit).

Terdapat dua kegunaan utama fosfatase alkali dalam manipulasi DNA:

1. Mengeluarkan 5′ fosfat daripada vektor plasmid dan bakteriofaj yang telah dipotong dengan enzim sekatan. Dalam tindak balas pengikatan seterusnya, rawatan ini menghalang pengikatan diri vektor dan dengan itu memudahkan pengikatan serpihan DNA lain ke dalam vektor (contohnya sub-pengklonan).

2. Mengeluarkan 5′ fosfat daripada serpihan DNA sebelum dilabelkan dengan fosfat radioaktif. Kinase polinukleotida jauh lebih berkesan dalam memfosforilasi DNA jika fosfat 5′ sebelum ini telah dialihkan.

Selalunya disyorkan bahawa penyahfosforilasi DNA dengan hujung tumpul atau 5′-menurut dijalankan menggunakan fosfatase alkali kepekatan yang lebih tinggi atau pada suhu yang lebih tinggi daripada DNA dengan 5′ overhang.

Taip # B. Pemindahan Terminal:

Pemindahan terminal memangkinkan penambahan nukleotida kepada terminus 3′ DNA. Menariknya, ia berfungsi pada DNA untai tunggal, termasuk 3′ overhang DNA untai dua, dan dengan itu merupakan contoh polimerase DNA yang tidak memerlukan primer. Ia juga boleh menambah homo-polimer ribo-nukleotida pada hujung 3′ DNA. Substrat yang paling disukai untuk enzim ini ialah menonjol 3′ hujung, tetapi ia juga akan, kurang cekap, menambah nukleotida kepada tumpul dan 3′-hujung serpihan DNA. Kobalt adalah kofaktor yang diperlukan untuk aktiviti enzim ini.

1. Melabelkan 3′ hujung DNA:

Selalunya, substrat untuk tindak balas ini ialah serpihan DNA yang dihasilkan oleh pencernaan dengan enzim sekatan yang meninggalkan 3′ tidak terjual, tetapi oligodeoxynucleotides juga boleh digunakan. Apabila DNA sedemikian diinkubasi dengan nukleotida bertanda dan pemindahan terminal, rentetan nukleotida bertanda akan ditambah pada 3′ tidak terjual atau pada hujung 3′ oligonukleotida (Rajah 13.5).

2. Menambah Ekor Homopolimer Pelengkap kepada DNA:

Prosedur pintar ini biasanya digunakan pada masa lalu untuk mengklon cDNA ke dalam vektor plasmid, tetapi sebahagian besarnya telah digantikan oleh teknik lain yang lebih cekap. Prinsip-prinsip teknik ini digambarkan dalam Rajah 13.6. Pada asasnya, pemindahan terminal digunakan untuk mengekori vektor plasmid linear dengan G’s dan cDNA dengan C’s. Apabila diinkubasi bersama, pelengkap G’s dan C’s menyepuhlindap untuk “memasukkan” cDNA ke dalam vektor, yang kemudiannya diubah menjadi E. coli.

Pemindahan terminal adalah enzim mamalia, dinyatakan dalam limfosit. Enzim yang dibeli secara komersial biasanya dihasilkan melalui ekspresi gen lembu dalam E. coli.

Taip # C. Polimerase DNA termostabil (TAQ Polymerase):

Sungguh menarik bagaimana beberapa penemuan yang tidak penting menjadi sesuatu yang amat penting selepas beberapa ketika. Begitulah sejarah Taq DNA polymerase. Laporan asal enzim ini, yang disucikan daripada bakteria mata air panas Thermus aquaticus, telah diterbitkan pada tahun 1976 (Rajah 13.7). Kira-kira 10 tahun kemudian, tindak balas rantai polimerase telah dibangunkan dan tidak lama selepas itu “Taq” menjadi perkataan biasa dalam kalangan biologi molekul. Pada masa ini, pasaran dunia untuk Taq polymerase mencecah ratusan juta dolar setiap tahun.

Polimerase DNA termofilik, seperti polimerase DNA lain, memangkinkan sintesis DNA terarah templat daripada nukleotida trifosfat. Primer yang mempunyai 3′ hidroksil percuma diperlukan untuk memulakan sintesis dan ion magnesium diperlukan.

Secara amnya, mereka mempunyai aktiviti pemangkin maksimum pada 75° hingga 80°C, dan mengaktifkan secara ketara pada suhu yang lebih rendah. Pada suhu 37°C, Taq polymerase hanya mempunyai kira-kira 10% daripada aktiviti maksimumnya. Sebagai tambahan kepada polimerase DNA Taq, beberapa polimerase DNA termostabil lain telah diasingkan dan dinyatakan daripada gen klon. Tiga daripada polimerase yang paling banyak digunakan diterangkan dalam Jadual 13.2.

Taip # D. Polimerase RNA Bacteriophage:

Polimerase RNA bergantung kepada DNA yang dikodkan Phage digunakan untuk transkripsi in vitro untuk menjana RNA yang ditentukan. Lazimnya, tindak balas menggunakan ribo-nukleotida yang dilabelkan dengan radio-nuklida atau beberapa tag lain, dan RNA berlabel yang terhasil digunakan sebagai probe untuk hibridisasi. Aplikasi lain transkripsi in vitro termasuk membuat RNA untuk terjemahan in vitro atau untuk mengkaji struktur dan fungsi RNA. Beberapa polimerase RNA bacteriophage boleh didapati secara komersial. Ia dinamakan sempena phage yang mengekodnya, dan sama ada disucikan daripada bakteria yang dijangkiti fag atau dihasilkan sebagai protein rekombinan.

Kebanyakan plasmid yang digunakan untuk membawa DNA klon menggabungkan promoter untuk polimerase RNA bacteriophage bersebelahan dengan tapak pengklonan. Ini membolehkan seseorang dengan mudah mendapatkan sama ada transkrip deria mRNA atau antisense daripada DNA yang dimasukkan. Proses ini sering dipanggil transkripsi larian, kerana plasmid dipotong dengan enzim sekatan di hilir DNA yang dimasukkan, yang menyebabkan polimerase jatuh dari templat apabila ia mencapai tempat itu.

Jika kita menganggap bahawa RNA yang ditranskripsikan (Rajah 13.8) mempunyai kekutuban mRNA (cth. deria), adalah mudah untuk mengubah suai binaan untuk menyatakan RNA antisens – hanya membalikkan orientasi kawasan yang ditranskripsikan. Sesungguhnya, kebanyakan plasmid yang digunakan untuk transkripsi in vitro mempunyai dua promoter polimerase fag berbeza yang mengapit tapak sisipan, yang membolehkan transkripsi RNA deria dengan satu polimerase dan antisense dengan yang lain.

Taip # E. Nuklease: DNase dan RNase:

Kebanyakan masa nuklease adalah musuh ahli biologi molekul yang cuba memelihara integriti sampel RNA atau DNA. Walau bagaimanapun, deoxyribonucleases (DNases) dan ribonucleases (RNases) mempunyai peranan tertentu yang sangat diperlukan dalam makmal biologi molekul.

Pelbagai jenis DNase dan RNase telah diasingkan dan dicirikan. Mereka berbeza antara lain dalam kekhususan substrat, keperluan kofaktor, dan sama ada ia membelah asid nukleik secara dalaman (endonucleases), mengunyah dari hujung (exonucleases) atau menyerang dalam kedua-dua mod ini.

Dalam kebanyakan kes, kekhususan substrat nuklease bergantung pada kepekatan enzim yang digunakan dalam tindak balas, dengan kepekatan tinggi menggalakkan pembelahan yang kurang spesifik. Nuklease yang paling banyak digunakan ialah DNase I dan RNase A, kedua-duanya disucikan daripada pankreas lembu: Deoxyribonuclease I membelah DNA untai dua atau untai tunggal. Pembelahan lebih disukai berlaku bersebelahan dengan sisa pirimidin (C atau T), dan oleh itu enzim adalah endonuklease. Produk utama ialah nukleotida di, tri dan tetra berfosforilasi 5′.

Dengan kehadiran ion magnesium, DNase I menghidrolisis setiap helai DNA dupleks secara bebas, menghasilkan belahan rawak. Dengan kehadiran ion mangan, enzim membelah kedua-dua helai DNA pada kira-kira tapak yang sama, menghasilkan hujung tumpul atau serpihan dengan 1-2 tapak terjual. DNase I tidak membelah RNA, tetapi persediaan kasar enzim tercemar dengan RNase A DNase bebas RNase I sedia ada.

Aplikasi:

1. Menghapuskan DNA (cth. plasmid) daripada persediaan RNA.

2. Menganalisis interaksi DNA-protein melalui cetakan kaki DNase.

3. Penyamaran DNA sebelum pelabelan radio dengan terjemahan nick.

Ribonuclease A ialah endoribonuclease yang membelah RNA untai tunggal pada hujung 3′ sisa pirimidin. Ia merendahkan RNA kepada 3′-fosforilasi mononukleotida dan oligonukleotida. Penggunaan utama RNase A adalah menghapuskan atau mengurangkan pencemaran RNA dalam penyediaan DNA plasmid.

Memetakan mutasi dalam DNA atau RNA dengan belahan tidak sepadan:

RNase akan membelah RNA dalam hibrid RNA-DNA di tapak ketidakpadanan asas tunggal, dan produk belahan boleh dianalisis. Sebilangan nuklease lain yang digunakan untuk memanipulasi DNA dan RNA diterangkan dalam Jadual 13.3.

a. Exonucleases ialah enzim (ditemui sebagai enzim individu, atau sebagai bahagian kompleks enzim yang lebih besar) yang membelah nukleotida satu demi satu daripada hujung rantai polinukleotida. Enzim-enzim ini menghidrolisis ikatan fosfodiester daripada sama ada terminus 3′ atau 5′ molekul polinukleotida (Rajah 13.9).

b. Endonuklease ialah enzim yang membelah ikatan fosfodiester dalam rantai polinukleotida, berbeza dengan exonuklease, yang membelah ikatan fosfodiester pada hujung rantai polinukleotida. Endonuklease sekatan (Enzim Sekatan) membelah DNA di tapak tertentu, dan dibahagikan kepada tiga kategori, Jenis I, Jenis II, dan Jenis III, mengikut mekanisme tindakannya. Enzim ini sering digunakan dalam kejuruteraan genetik untuk membuat DNA rekombinan untuk pengenalan ke dalam sel bakteria, tumbuhan atau haiwan (Rajah 13.10).

Taip # F. Polinukleotida Kinase:

Polynucleotide kinase (PNK) ialah enzim yang memangkinkan pemindahan fosfat daripada ATP ke hujung 5′ sama ada DNA atau RNA. Ia adalah produk bakteria T4, dan persediaan komersil biasanya produk daripada gen phage klon yang dinyatakan dalam E. coli.

Aktiviti enzimatik PNK digunakan dalam dua jenis tindak balas:

1, Dalam “tindak balas hadapan”, PNK memindahkan gamma fosfat daripada ATP ke hujung 5′ polinukleotida (DNA atau RNA). Nukleotida sasaran kekurangan fosfat 5′ sama ada kerana ia telah dinyahfosforilasi atau telah disintesis secara kimia.

2. Dalam “reaksi pertukaran”, DNA sasaran atau RNA yang mempunyai 5′ fosfat diinkubasi dengan lebihan ADP, PNK akan terlebih dahulu memindahkan fosfat daripada asid nukleik ke ADP, membentuk ATP dan meninggalkan defosforilasi. sasaran. PNK kemudiannya akan melakukan tindak balas ke hadapan dan memindahkan fosfat daripada ATP ke asid nukleik sasaran (Rajah 13.11).

Seperti yang anda jangkakan, kecekapan memfosforilasi melalui tindak balas pertukaran adalah jauh lebih rendah daripada tindak balas hadapan. In addition to its phosphorylating activity, PNK also has 3′ phosphatase activity, although this has little significance to molecular technologists.

There are two major indications for phosphorylating nucleic acids and hence uses of PNK are:

1. Phosphorylating linkers and adaptors (fragments of DNA ready for ligation) which require a 5′ phosphate. This includes products of polymerase chain reaction, which are typically generated using non-phosphorylated primers.

2. Radiolabelling oligonucleotides, usually with 32P, for use as hybridization probes. PNK is inhibited by small amounts of ammonium ions, so ammonium acetate should not be used to precipitate nucleic acids prior to phosphorylation. Low concentrations of phosphate ions, or NaCl concentrations greater than about 50 mM, also inhibit this enzyme.

Taip # G. DNA Ligase:

The term recombinant DNA includes the concept of recombining fragments of DNA from different sources into a new and useful DNA molecule. Joining linear DNA fragments together with covalent bonds is called ligation. More specifically, DNA ligation involves creating a phosphodiester bond between the 3′ hydroxyl of one nucleotide and the 5′ phosphate of another.

The enzyme used to ligate DNA fragments is T4 DNA ligase, which originates from the T4 bacteriophage. This enzyme will ligate DNA fragments having overhanging, cohesive ends that are annealed together, as in the EcoRI (Fig. 13.12). This is equivalent to repairing “nicks” in duplex DNA. T4 DNA ligase will also ligate fragments with blunt ends, although higher concentrations of the enzyme are usually recommended for this purpose.


General PCR application information

What factors are critical for multiplex PCR?

All primer pairs used in multiplex PCR should have similar priming efficiencies for their target DNA. This can be achieved by using primers with nearly identical optimum annealing temperatures.

When designing primers, pay special attention the following parameters:

  • Homology with the target nucleic acid sequence
  • Panjang
  • GC content
  • Concentration
  • Primer homology (primers should not have homology either internally or with one another, especially at the 3' ends)

What is nested PCR?

Nested PCR is a method that involves re-amplification to improve PCR results. Nested PCR involves designing a new forward-nested (FN) or reverse-nested (RN) primer that is internal to the original primer and can pair with the original partner primer. A very small amount of the primary PCR product is used as a template for PCR with nested primers.

Nested PCR frequently leads to improved yield of the desired PCR product by:

  • Eliminating extra bands that may have been present in the initial PCR
  • Producing a robust band that may have been weak or invisible in the initial PCR

It is important to note that only a very small amount of the primary product should be used in nested PCR because this template has very low sequence complexity. To start, the primary PCR product can be diluted 1:100, and 1 µl can be used as the template for nested PCR. Also, you may need to reduce the number of cycles to 25&ndash30. The optimal conditions for nested PCR should be determined empirically.

What is touchdown PCR (TD-PCR) and when would I need to use it?

During the PCR denaturation step, all DNA molecules will become single stranded. When the temperature decreases for annealing, three types of duplexes can be formed:

  • Homoduplexes&mdashannealing of complementary strands
  • Heteroduplexes&mdashcross-hybridization of homologous sequences that may have partial homology
  • Duplexes between primers and template

To achieve higher specificity, heteroduplex formation should be minimized by increasing stringency (i.e., increasing the temperature) during the initial PCR cycles. Touchdown PCR increases specificity by using reaction conditions that gradually reduce the annealing temperature. The initial annealing temperature is set to several degrees above the estimated Tm of the primers. In subsequent cycles, the annealing temperature is slowly decreased until it reaches the calculated annealing temperature of the primers (Don 1991). By using a higher annealing temperature in the initial PCR cycles, touchdown PCR favors accumulation of amplicons for sequences with the highest primer-template complementarity, thereby enriching for the most specific amplicons. Transitioning to a lower temperature during subsequent cycles reduces stringency, improving priming conditions with the already enriched, desired template. We recommend performing an initial 5&ndash10 cycles with the higher annealing temperature, and then gradually decreasing the temperature until the optimal annealing temperature, or "touchdown temperature," is reached. For example, if the Tm of your primers is 68°C, the recommended TD-PCR conditions for the annealing temperature are:

Rujukan

Don, R. H., et al. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucl Acids Res. 19(14):4008 (1991).

How can I clone a blunt-end PCR product into a TA-cloning vector?

If a PCR product is amplified with a high-fidelity polymerase that generates blunt ends, you can perform A-tailing using Taq polimerase. A brief protocol for adding 3' A-overhangs to PCR products is provided below.

  1. Purify the PCR product. Before adding overhangs, it is very important to remove all of the polymerase in the reaction by purifying the PCR product using a PCR purification kit or by phenol extraction and DNA precipitation. This step is critical, since the proofreading activity of any residual DNA polymerase would degrade the A overhangs, thus recreating blunt ends.
  2. Prepare the Taq DNA polymerase reaction mix:

*The A-addition reaction works best when a specific amount of the PCR product is used. The recommended amount is 10&ndash100 ng per 100 bp of the PCR product. This corresponds to 0.15&ndash1.5 pmol of PCR product (see table below).

PCR product size Amount of PCR product to use
100 bp 10&ndash100 ng
250 bp 25&ndash250 ng
1,000 bp 100&ndash1,000 ng

3. Incubate for 20 min at 72°C.

Proceed to TA cloning. For optimal ligation efficiency, it is best to use fresh PCR products, since 3' A-overhangs will gradually be lost during storage.

Which polymerases generate blunt ends versus A-overhangs?

  • Enzymes in the PrimeSTAR series
    These enzymes exhibit substantial 3'&rarr5' exonuclease activity and primarily generate amplification products with blunt ends. Therefore, we recommend using the Mighty Cloning Reagent Set (Blunt End) for blunt-end cloning.
  • Taq and Terra enzymes
    Takara Taq, Takara Cth Taq, Takara LA Taq, SpeedSTAR HS, EmeraldAmp, SapphireAmp Fast, and Terra PCR DNA polymerases primarily yield amplification products containing 3'-dA overhangs that can be directly used for TA-cloning. Blunt-end cloning is also possible using the Mighty Cloning Reagent Set (Blunt End).
  • All Takara Bio DNA polymerases
    The fragment terminal structure after amplification with a particular polymerase is indicated in the table below. Some polymerases generate a mixture of blunt-end and A-overhang products other polymerases generate only blunt-end or A-overhang products.

Polymerase A-overhang hujung tumpul
Takara Taq DNA polymerases
Takara Cth Taq DNA polymerases
Takara LA Taq DNA polymerases
Titanium Taq DNA Polymerase
Advantage 2 Polymerase Mix
Advantage GC 2 Polymerase Mix
Advantage HF 2 Polymerase Mix
EmeraldAmp GT PCR Master Mix
EmeraldAmp MAX HS PCR Master Mix
SapphireAmp Fast PCR Master Mix
High Yield PCR EcoDry Premix
High Fidelity PCR EcoDry Premix
Terra PCR Direct Polymerase Mix
SpeedSTAR HS DNA Polymerase
PrimeSTAR HS DNA Polymerase
PrimeSTAR GXL DNA Polymerase
PrimeSTAR Max DNA Polymerase
CloneAmp HiFi PCR Premix
SeqAmp DNA Polymerase
TaKaRa Z-Taq DNA Polymerase
e2TAK DNA Polymerase
PerfectShot Cth Taq DNA Polymerase

What is meant by polymerase fidelity? What applications require a high-fidelity polymerase?

The fidelity of a DNA polymerase refers to its ability to accurately replicate a template, or to add the correct nucleotides starting at the 3' end of the primer. The rate of base misincorporation is known as the error rate. PCR polymerases with proofreading activity possess 3'&rarr5' exonuclease activity that can excise incorrectly incorporated nucleotides and replace them with the correct nucleotides.

High-fidelity polymerases are recommended for gene cloning, protein expression, structure-function studies of proteins, cDNA library construction, and next-generation sequencing. To select a high-fidelity polymerase, see our PCR selection guide.

How can I compare error rates of different high-fidelity polymerases?

Error rates reported by vendors for polymerases cannot always be directly compared, as different methods are used to measure fidelity. These methods include:

  1. Blue-white screening
    This approach is based on phenotypic changes and is widely used since it is fast, relatively simple, and cost effective. The original method for blue-white screening, known as the Kunkel method (Kunkel and Tindall 1987), is based on &alpha-complementation of the lacZ&alpha gene that restores &beta-galactosidase enzyme activity and allows production of a blue color. With this method, colonies derived from lacZ&alpha PCR products containing single-nucleotide errors or frameshift mutations typically have a white color, while clones derived from error-free amplicons generate blue colonies.
  2. Sequencing approach
    This approach utilizes Sanger sequencing of individual colonies after PCR. The blue-white screening approach can quickly measure polymerase fidelity, however it is not as accurate as the sequencing approach. The blue-white method will not detect silent mutations, single-nucleotide substitutions that do not affect translation. The sequencing method can detect all mutations, and thus is more accurate.

Rujukan

Kunkel, T. A. and Tindall, K. R., Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biokimia 27, 6008&ndash6013 (1987).

PrimeSTAR Max and PrimeSTAR GXL DNA polymerases have very high fidelity how was fidelity measured for these enzymes?

The fidelities of the PrimeSTAR polymerases were measured by Sanger sequencing of individual colonies after PCR, as described below:

  • Ten arbitrarily selected GC-rich regions of Termus thermophilus HB8 genomic DNA were amplified.
  • PCR products were cloned into a plasmid vector.
  • Multiple clones were selected for each respective amplification product, and the PCR insert was sequenced.

PrimeSTAR Max DNA Polymerase has a fidelity 29X that of Taq polymerase, whereas PrimeSTAR GXL DNA Polymerase has a fidelity 6.5X that of Taq polimerase.

What precautions should be taken when using inosine-containing primers?

Inosine-containing primers should not be used with PCR enzymes that have 3'&rarr5' exonuclease activity (e.g., PrimeSTAR HS DNA Polymerase, PrimeSTAR Max DNA Polymerase, PrimeSTAR GXL DNA Polymerase, TaKaRa Ex Taq DNA Polymerase, or Takara LA Taq DNA polymerases), nor with Terra PCR Direct polymerase. When using one of the compatible Takara TaqPCR enzymes for degenerate PCR, we recommend using a mixture of degenerate primers with A, T, G, or C at the desired position(s) rather than inosine-containing primers.


LIC cloning

L igation I ndependent C loning (LIC) uses the 3′ exonuclease activity of T4 DNA Polymerase to chew back constructs to a particular base, and then uses the resulting sticky ends to paste a gene into the correct place in a vector. This is followed with transformation to bacteria to repair the nicked strands and make more DNA.

T4 DNA polymerase has 3′ exonuclease activity: in the absence of NTPs, it will chew back the 3′ end of double stranded DNA. This reaction competes with the addition of bases in the 5′-3′ direction on the same strand. If we add a large number of dNTPs, the polymerase activity will overwhelm the exonuclease activity and the 3′ end will extend. Things get interesting if we add only a single dNTP. Let’s say we add dGTP. The polymerase will chew back until it reaches a “C” on the opposite strand. It will then incorporate the dGTP. There is then a competition between the exonuclease — going backwards — and adding the G — going forwards. As long as there is dGTP around, the polymerase will sit stalled at that position. By carefully designing a DNA construct, one can use this stalling behavior to create long sticky ends to paste DNA together.

Our vector (derived from pET28/30) has an SspI site that cuts in the following location. The soon-to-be sticky ends are blue and green the “G” at which the polymerase stalls is shown in bold red.

To create an insert for LIC cloning, we amplify our gene of interest using primers that have special LIC ends (bold) that will be complementary to the vector LIC ends. The other end of each primer is complementary to our gene of interest.

Do T4 DNA polymerase reaction with only dCTP, which will chew back the 3′ ends until the reaction hits the first C (bold red):

Note the long length of the vector and insert that are complementary (blue and green). The last step is to anneal the vector and the insert and then transform into bacteria to repair breaks.

VECTOR INFORMATION:

Sequencing primers:
MalE (forward): GGTCGTCAGACTGTCGATGAAGCC
T7Term (reverse): GCTAGTTATTGCTCAGCGG

I. Vector Prep:

    Cut vector (5 ug) with SspI in 150 uL volume for

In thermocycler, incubate at 22 °C for 30 minutes, 75°C for 20 minutes and 4°C for 5 minutes

II. Insert Prep:

1. PCR amplify insert using special LIC cloning primers.
2. Digest PCR product with 1 uL DpnI for 1-2 hours @ 37°C to remove template vector (if it contains Amp-resistance gene).
3. Clean up DpnI-digested PCR product with Qiagen PCR Kit – 30 uL
4. Phosphorylate PCR product

30 uL (500 ng) PCR product
4 uL 10X T4 ligase buffer
1 uL T4 PNK
5 uL H2O
40 uL total

In thermocycler, incubate at 37°C for 1.5 hr, 65°C for 20 minutes and 4°C for 5 minutes

5. Perform dCTP PCR product overhang reaction

40 uL phosphorylated PCR product above
0.5 uL 1 M DTT
1.25 uL 100 mM dCTP
0.5 uL T4 DNA polymerase-LIC Novagen
2.7 uL NEB2
5 uL H2O
50 uL total

In thermocycler, incubate at 22 °C for 30 minutes, 75°C for 20 minutes and 4°C for 5 minutes


Ligation Independent Cloning

Ligation Independent Cloning (LIC) relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme which removes nucleotides from the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs of 10-12 base pairs on the 5' end of both the vector and insert. These overhangs can easily anneal creating a circular product with four nicks that are repaired by the bacteria after transformation. LIC does not require site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method.

So how does this work exactly? LIC depends on the addition of only one free dNTP to the reaction. In the presence of a single free dNTP, T4 polymerase will continue to function as an exonuclease until a base is exposed on the single strand overhang which is complementary to the free nucleotide. Given this opportunity, T4 will resume its polymerase activity, add back the free base, and become stuck at this point (with no other free bases to add). Complementary overhangs are built into the PCR primers for the insert, based on the destination vector sequence and choice of restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation is rendered unnecessary. The product may be transformed directly into E coli, where the nicks will be repaired by the normal replication process. It is important to note that LIC has difficulty assembling DNA fragments with repetitive sequences and DNA that ends in sequences that form complex secondary structues. You can view an example of a LIC protocol on our website.

Ligation Independent Cloning (Figure adapted from LIC protocol)


Can Pfx polymerase add only one 3' A overhang? - Biologi

Molecular Biology Laboratory Topics

Molecular Biology Review

Replication is the process by which DNA is synthetized in vivo, and requires a pre-existing DNA molecule as template, a primer, a replication origin, DNA polymerase, deoxynucleotides (dNTPs), and ligase. It starts with the unwinding of a DNA template and separation of the strands forming a structure known as a replication fork. Each strand can then serve as a template. A shot RNA sequence serves as a primer by annealing to the replication origin, for example, to ori C in the E coli circular chromosome. Eukaryotes have many replication origins because they have more than one chromosome. DNA polymerase recognizes and binds to the replication origin, the starts catalyzing the addition of nucleotides to the primer.

DNA replication always moves from the 5' end to the 3' end of the newly synthezized molecule. Because one of the template strands is not completely unwond, replication of that strand occurs in pieces, adding new primers as the template unwinds. The DNA fragments produced are known as Okazaki fragments and are eventually joined by ligase. The new DNA strand synthetized in fragments is known as the lagging strand, while the strand synthetized continuously is known as the leading strand.

Usually, a molecule of DNA polymerase does not compleately replicates a strand, but "jumps around" from template to template. This phenomenom is known as distrivuive synthesis. Some isozymes stay on one tamplate longer than others, thus are more efficient or have better processivity.

Example Procedure: Bacterial DNA Isolation

Use lysosime to digest cell wall (contained in Solution I). There is EDTA in most of the reagents to chelate Mg2+ to inhibit DNase. Cell membrane is disolved using 0.5% SDS (contained in Solution II) to release DNA, RNA, proteins, carbohydrates and lipids. DNA is not soluble in phenol, but lipid, proteins and some carbohydrates are, thus the mixture is extracted with phenol several times. Chloroform is the used to remove more lipids, as well as some proteins and carbos. The clean DNA is precipitated by adding ethanol, and charges are neutralized with NaOAC (sodium acetate).

Example Procedure: DNA Resin Extraction

Example Procedure: DNA Electroelution

Nucleases cut at either side of the phosphodiester bond of polynucleotides:

Some nucleases cut both DNA and RNA, while others cut only DNA (DNases) or only RNA (RNases). Nucleases that cut only at or near the end of a polynucleotide are known as exonucleases, while endonucleases only cut at interior base pairs. Some commonly used nucleases are Bal31, ExoIII, S1, mung bean nuclease, DNase 1, RNase A and RNase H.

Bal31 is obtained from Alteromones espejiana and cuts polynucleotides. It acts as a single strand endonuclease and a double strand exonuclease in the prescence of Ca2+. Bal31 is commonly used to make division, for example to isolate the sequence of interest and make blunt ends by removing unwanted base pairs.

ExoIII recognizes double stranded polynucleotides but cut only one strand. It is a 3'-to-5' exonuclease that leaves a 5' overhang, but cannot cut if there is a 3' overhang. ExoIII is used as Bal31, then another enzyme is used to remove the 5' overhang.

S1 nuclease from Aspergillus oryzae cuts polynucleotides as either an endonuclease or an exonuclease in the prescence of Zn2+. It is single strand specific, but will cut a double strand that is already nicked. Mung bean nuclease is identical to S1 except it will not cut nicked double stranded DNA.

DNase 1 is a DNA endonuclease. If Mg2+ is present, DNase 1 will recognize double stranded DNA but cut only one strand. If Mn2+ is present, it will cut both strands.

RNase H cuts only the RNA in RNA/DNA hybrid helices. RNase A is specific to single stranded RNA (cannot cut at hairpins), cutting in front of C or U.

Restriction Endonucleases

Restriction endunucleases originate from one of two enzymatic systems in bacteria: hsd (host specificity for DNA) or MDRS (methylation-dependent restriction system).

The hsd genes confere protection to bacteria against bacteriophages (viruses that infect bacteria). Different strains of bacteria have different hsd genes that produce restriction endonucleases and methylases. The methylases modify bacterial DNA by methylating at either adenine or cytocine. The restriction endonucleases degrade DNA if not methylated, protecting the bacteria from non-methylated foreign DNA.

But some bacteriophages may also methylate their DNA, thus using hsd bacteria may be able to protect themselves only against bacteriophages with methylation patterns different to their own. For example, if the bacteriophage lambda kappa infects E coli kappa, the bacteria will not be able to fight the infection because both organisms have the same methylation pattern. On the other hand, restriction endonucleases from E coli beta should be able to degrade lambda kappa.

The MDRS enzymes cut methylated DNA only, thus E. coli does not methylate its own genomic DNA at the MDRS recognition sites, thus the MDRS system does not produce methylases as hsd do. MDRS genes may be of two types: modified cytosine restriction (MCR) or methyladenine recognition restriction (MAR).

Restriction endonucleases degrade bacteriophage DNA by cutting at specific double-stranded DNA sequences (they do not cut single stranded DNA), for example:

5' ----- GAATTC ----- 3'
3' ----- CTTAAG ----- 5'
EcoRI
5' ----- G AATTC ----- 3'
3' ----- CTTAA G ----- 5'

An enzyme like EcoRI (from E coli) leaves "sticky ends" with a 5' overhang. Other enzymes may leave either a 3' ovehang or blunt ends:

Pstsaya

Alusaya

5' ----- CTGCA G ----- 3'
3' ----- G CTGCA ----- 5'

There are three types of restriction endonucleases. The most commonly used Type II restriction endonucleases are simple proteins that require only Mg2+ and generally cut at a palindromic host specific recognition site. Other types of restriction endonuclease require Mg2+, AdoMet and/or ATP and may cut many base pairs away from the recognition site, sometimes at random.

Isoschizomers are restriction endonucleases that recognize the same sequence and may cut at the same or different bases. If they cut at different bases, they are called neoschizomers. Isoschizomers may be affected differently by methylation. Sebagai contoh: MboI, Sau3A and DpnI are isochizomers (DpnI is a neoschizomer) that recognize 5'--GATC--3'. MboI will cut only the unmethylated sequence, Sau3A will cut either the one-strand methylated or unmethylated sequence, and DpnI will cut only if the sequence is metylated in both strands.

Synthesis and Modification Enzymes

Synthetic enzymes include DNA polymerases and RNA polymerases. There are many isozymes of DNA polymerase, some commonly use in biolotechnology are E coli, T7, T4, Taq and reverse transcriptase.

E. coli DNA polymerase has two subunits: a 76 kD 5' to 3' polymerase and a 35 kD 3' to 5' exonuclease. The exonuclease only cut one strand of the double stranded DNA, and in the bacteria is used to proofread a newly sinthezized DNA strand. The polymerase does not recognize individual nucleotides, it just ads any nucleoride, and it is up to the exonuclease to identify the incorrect pairings and remove the wrong nucleotide just added. The 3'-to-5' exonuclease identidies the wrong bases by reconizing that the H bonds are not forming. Such proofreading will continue until the correct base is in place.

T7 DNA polymerase, also known as sequenace (?), is made of two subunits: 5' to 3' polymerase and 3' to 5' exonuclease. Although similar to E coli, T7 has better processivity, therefore it is often used for manual DNA sequencing.

T4 DNA polymerase also has the 5' to 3' polymerase and 3' to 5' exonuclease activities, but its exonuclease is single-strand specific. It is mostly used to remove 3' overhangs.

Taq DNA polymerase comes from Thermus aquaticus, a bacteria that lives in hot springs. It is used for reactions that need to occur at very high temperatures, like the polymerase chain reaction (PCR).

There are also many RNA polymerase isozymes. Prokaryotic isozymes like E coli RNA polymerase make mRNA, tRNA and rRNA. Other commonly used RNA polymerases includ Sp6 (from Salmonella), T7 and T3. Eukaryotic have different RNA polymerases that make the divers kinds of RNA:

  • RNA Polymerase I: 18s, 28s and 5.8 s rRNA
  • RNA Polymerase II: mRNA and snRNA
  • RNA Polymerase III: tRNA and 5s rRNA

Modification enzymes include methylases, lagases, alkaline phosphatases and kinases. As already discussed, methylases add a methyl group at either adenine or cytocine:

Ligases join two pieces of DNA together by forming phosphodiester bonds:

Phosphatases remove the 5' phosphate of polynucleotides, while kinase adds a phosphate to an already dephosphorilated DNA 5' end.


Ucapan terima kasih

We thank V. Kalinin, V. Krutyakov, G. Villani, C. Bieri and U. Sheveleva for their critical reading of the manuscript Ursi Hübscher, R. Hobi, P. Schrafll and N. Pirogova for their assistance with graphics T. Steitz for permission to reproduce Figure 1 and K. Ramadan for his assistance on the manuscript. The work carried out in the authors' laboratories was supported by the Swiss National Science Foundation, the European Union TMR grant, the Kanton of Zürich and the Russian Foundation for Basic Research. We apologize to those researchers whose work could not be cited directly because of the strict limit on the number of references.


Tonton video: PCR Polymerase Chain Reaction 2 of 4 (Februari 2023).