Maklumat

Kerosakan DNA yang dimediasi secara transkripsi

Kerosakan DNA yang dimediasi secara transkripsi


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Saya sedang menyelidik genetik kanser otak, dan menemui sejumlah besar mutasi dalam saluran berpagar voltan. Ada sebabnya bahawa sebahagian daripada kerosakan DNA ini disebabkan oleh DNA yang ditranskripsikan secara besar-besaran, atau dalam penyesuaian kromatin terbuka lebih kerap, yang menyebabkan lebih banyak kerosakan dan kerosakan akibat tekanan persekitaran.

Sudah tentu, itu hanya dugaan. Adakah sesiapa tahu mana-mana kertas penyelidikan di kawasan itu?


Nampaknya terdapat beberapa bukti kukuh bahawa transkripsi menggalakkan mutasi kerana helai yang tidak ditranskripsi mampu membentuk struktur sekunder yang mendedahkan asas kepada mutagenesis kimia.

Berikut adalah makalah terbaru mengenai mutagenesis berkaitan transkripsi:

Kim H et al.(2010) Mutagenesis berkaitan transkripsi meningkatkan kepelbagaian urutan protein dengan lebih berkesan daripada mutagenesis rawak dalam Escherichia coli. PLoS One 5 (5): e10567. doi: 10.1371/journal.pone.0010567.

Daripada abstrak:

Semasa transkripsi, untai DNA yang tidak ditranskripsi menjadi DNA untai tunggal (ssDNA), yang boleh membentuk struktur sekunder. Bes tidak berpasangan dalam ssDNA kurang dilindungi daripada mutagen dan oleh itu mengalami lebih banyak mutasi daripada bes berpasangan. Mutasi ini disebut mutasi yang berkaitan dengan transkripsi. Mutagenesis berkaitan transkripsi meningkat di bawah tekanan dan bergantung pada urutan DNA. Oleh itu, pemilihan mungkin mempengaruhi jujukan pengekodan protein dengan ketara dari segi kebolehubahan yang berkaitan dengan transkripsi setiap peristiwa transkripsi di bawah tekanan untuk meningkatkan kemandirian Escherichia coli.

Penulis memetik sejumlah makalah dalam pendahuluan mereka yang mendokumentasikan fenomena yang boleh anda ikuti. Sekiranya tumpuan pada sistem bakteria membebaskan anda, Kim et al. makalah pula telah dipetik dalam:

Wright et al. (2011) Peranan transkripsi dan genotoksin yang mendasari mutagenesis p53 in vivo. KARCINOGENESIS 32: 1559-1567

Abstrak sepenuhnya:

Transkripsi mendorong lapisan super yang membentuk dan menstabilkan struktur sekunder DNA helai tunggal dengan gelung yang mendedahkan asas G dan C yang secara intrinsik boleh berubah dan rentan terhadap reaksi hidrolitik bukan enzimatik. Oleh kerana banyak kajian di prokariota menunjukkan korelasi langsung antara frekuensi transkripsi dan mutasi, kami melakukan analisis silico menggunakan program komputer, mfg, yang mensimulasikan transkripsi dan meramalkan lokasi pangkalan berubah yang diketahui dalam gelung struktur sekunder kestabilan tinggi. Analisis Mfg bagi gen penindas tumor p53 meramalkan lokasi asas boleh berubah dan frekuensi mutasi berkorelasi dengan sejauh mana asas boleh berubah ini terdedah dalam struktur sekunder. Analisis in vitro kini telah mengesahkan bahawa 12 pangkalan yang paling boleh berubah dalam p53 sebenarnya terletak dalam gelung ssDNA yang diramalkan bagi struktur ini. Data menunjukkan bahawa genotoksin mempunyai dua kesan bebas terhadap mutagenesis dan kejadian kanser: Pertama, mereka mengaktifkan transkripsi p53, yang meningkatkan bilangan asas boleh ubah terdedah dan juga meningkatkan kekerapan mutasi. Kedua, genotoksin meningkatkan kekerapan transversi G-to-T yang mengakibatkan penurunan mutasi G-to-A dan C. Pergeseran kompensasi tepat dalam 'nasib' mutasi G ini tidak memberi kesan pada frekuensi mutasi. Lebih-lebih lagi, ini selaras dengan mekanisme mutagenesis yang kami cadangkan di mana frekuensi pendedahan G dalam ssDNA melalui transkripsi adalah kadar yang terhad untuk frekuensi mutasi in vivo.


Kami secara amnya menerima tanggapan bahawa replikasi dengan setia menduplikasi bahan genetik. Pada masa yang sama, evolusi tidak akan mungkin dilakukan tanpa mutasi, dan mutasi tidak mungkin dilakukan tanpa sekurang-kurangnya beberapa akibat buruk.

Mutasi Germline boleh diwarisi. Apabila terdapat dalam satu, tetapi terutama pada kedua alel gen, mutasi tersebut boleh mengakibatkan penyakit genetik (mis., Penyakit Tay-Sach & rsquos, fibrosis kistik, hemofilia, anemia sel sabit, dll.). Daripada menyebabkan penyakit, beberapa mutasi kuman dapat meningkatkan kemungkinan menjadi sakit (cth., mutasi gen BRCA2 sangat meningkatkan kemungkinan wanita mendapat kanser payudara). Mutasi somatik secara aktif membelah sel boleh mengakibatkan tumor jinak & ldquocysts & rdquo atau malignan (iaitu, barah). Mutasi somatik lain mungkin memainkan peranan dalam demensia (penyakit Alzheimer&rsquos) atau dalam beberapa neuropatologi sepanjang spektrum autisme.

Oleh kerana kimia replikasi yang kompleks dikenakan kadar kesalahan tinggi yang melekat, sel-sel telah mengembangkan sistem pembaikan DNA untuk bertahan dengan kadar mutasi yang tinggi. Seperti yang kita lihat, polimerase DNA sendiri mempunyai kemampuan membaca semula sehingga pangkalan yang tidak betul dapat dengan cepat dikeluarkan dan diganti. Di luar ini, pelbagai mekanisme telah berkembang untuk membaiki pasangan asas yang tidak sepadan dan jenis DNA lain yang rosak yang terlepas daripada pengesanan awal. Seberapa kerap dan di mana kerosakan DNA berlaku secara rawak, seperti mana kerosakan akan diperbaiki dan yang akan melarikan diri untuk menjadi mutasi. Bagi mereka yang mengalami akibat buruk daripada mutasi yang tidak dibaiki, keseimbangan antara DNA yang disimpan dan dibaiki, kerosakan sekurang-kurangnya, tidak sempurna. Walau bagaimanapun, evolusi dan kesinambungan kehidupan itu sendiri bergantung pada keseimbangan ini.


Kerosakan DNA

Semua DNA mengalami kerosakan dari semasa ke semasa, daripada pendedahan kepada ultraungu dan sinaran lain, serta daripada pelbagai bahan kimia dalam persekitaran (Rajah 7.34 & 7.35). Bahkan tindak balas kimia yang berlaku secara semula jadi dalam sel dapat menimbulkan sebatian yang boleh merosakkan DNA. Seperti yang anda sedia maklum, walaupun perubahan kecil dalam jujukan DNA, seperti mutasi titik kadangkala boleh membawa kesan yang meluas. Begitu juga, kerosakan yang tidak diperbaiki yang disebabkan oleh sinaran, bahan kimia alam sekitar atau kimia selular biasa boleh mengganggu penghantaran maklumat yang tepat dalam DNA. Mengekalkan integriti "blueprint" sel adalah amat penting dan ini ditunjukkan dalam pelbagai mekanisme yang wujud untuk membaiki kesilapan dan kerosakan dalam DNA.

Rajah 7.34 - Pecah kromosom - Wikipedia Gambar 7.35 - DNA yang rosak tunggal (atas) dan dua helai (bawah) - Wikipedia


Tindak balas Kerosakan DNA

Pemeliharaan integriti dan kesetiaan genom sangat penting untuk fungsi dan kelangsungan hidup semua organisma yang betul. Tugas ini amat menakutkan kerana serangan berterusan terhadap DNA oleh agen genotoksik (kedua-dua endogen dan eksogen), salah penyatuan nukleotida semasa replikasi DNA, dan ketidakstabilan biokimia intrinsik DNA itu sendiri. 1

Kegagalan untuk membaiki lesi DNA boleh mengakibatkan penyumbatan transkripsi dan replikasi, mutagenesis dan/atau sitotoksisiti selular. 2 Pada manusia, kerosakan DNA terbukti terlibat dalam pelbagai gangguan genetik, dalam penuaan, 3 dan karsinogenesis. 4, 5


Lihat Imej Lebih Besar
Rajah 1. Tindak balas Kerosakan DNA. Kerosakan DNA disebabkan oleh pelbagai sumber. Respons selular terhadap kerosakan mungkin melibatkan pengaktifan pusat pemeriksaan kitaran sel, permulaan program transkrip, pelaksanaan perbaikan DNA, atau ketika kerusakan parah, permulaan apoptosis.

Semua sel eukariotik telah mengembangkan tindak balas pelbagai rupa untuk mengatasi kesan kerosakan DNA yang berpotensi merosakkan (Rajah 1). 2 Apabila mengesan kerosakan DNA atau gerai dalam replikasi, pusat pemeriksaan kitaran sel diaktifkan untuk menahan perkembangan kitaran sel bagi memberi masa untuk pembaikan sebelum kerosakan itu diteruskan kepada sel anak. Sebagai tambahan kepada pengaktifan pusat pemeriksaan, tindak balas kerosakan DNA menyebabkan terjadinya program transkripsi, peningkatan jalur pembaikan DNA, dan ketika tingkat kerusakan parah, untuk memulai apoptosis. 6 Semua proses ini diselaraskan dengan teliti supaya bahan genetik diselenggara, diduplikasi dan diasingkan dengan setia di dalam sel.

Pusat Pemeriksaan Kitaran Sel

Pusat pemeriksaan kitaran sel ialah laluan kawal selia yang mengawal susunan dan masa peralihan kitaran sel untuk memastikan penyiapan satu peristiwa selular sebelum permulaan yang lain. Pengawal selia utama laluan pemeriksaan dalam tindak balas kerosakan DNA mamalia ialah kinase protein ATM (ataxia telangiectasia, bermutasi) dan ATR (ATM dan Rad3). Kedua-dua protein ini tergolong dalam keluarga kinase serine-threonine yang unik dari segi struktur yang dicirikan oleh motif pemangkin terminal-C yang mengandungi domain 3-kinase fosfatidillinositol. 7, 8 Walaupun ATM dan ATR kelihatan memfosforilasi banyak substrat selular yang sama, 9 mereka secara amnya bertindak balas terhadap jenis kerosakan DNA yang berbeza. ATM adalah pengantara utama tindak balas terhadap pemecahan untai ganda DNA (DSB) yang boleh timbul dengan pendedahan kepada radiasi pengion (IR). ATR, sebaliknya, hanya memainkan peranan sandaran dalam tindak balas DSB, tetapi mengarahkan tindak balas prinsip kepada kerosakan UV dan gerai dalam replikasi DNA.


Lihat Imej Lebih Besar
Gambar 2. Laluan Pemeriksaan Kitaran Sel Mamalia. Sebagai tindak balas terhadap kerosakan DNA, ATM dan / atau ATR mencetuskan pengaktifan pusat pemeriksaan yang menyebabkan penangkapan atau penundaan kitaran sel. Laluan pusat pemeriksaan dicirikan oleh lata peristiwa fosforilasi protein (ditandakan dengan "P") yang mengubah aktiviti, kestabilan atau penyetempatan protein yang diubah suai. Gambaran keseluruhan umum laluan pusat pemeriksaan kitaran sel G1, S dan G2 ditunjukkan (masing-masing panel kiri, tengah dan kanan). Lihat teks utama untuk maklumat tambahan.

G1 Checkpoint

Pusat pemeriksaan kitaran sel G1 menghalang DNA yang rosak daripada direplikasi dan merupakan pusat pemeriksaan yang paling difahami dalam sel mamalia (Rajah 2). 10 Pusat ke pusat pemeriksaan ini adalah pengumpulan dan pengaktifan protein p53 dua sifat yang dikendalikan dengan teliti oleh ATM dan kinase ATR. Dalam sel yang biasanya tumbuh, tahap p53 adalah rendah kerana interaksi dengan MDM2, yang mensasarkan p53 untuk eksport nuklear dan degradasi pengantara proteosom dalam sitoplasma. 11 Berikutan kerosakan IR, ATM mengaktifkan kinase hiliran Chk2 (melalui fosforilasi pada kedudukan T68), 12 yang seterusnya memfosforilasi sisa S20 p53. Fosforilasi S20 p53 menyekat interaksi p53/MDM2, mengakibatkan pengumpulan p53. ATM menggunakan langkah kawalan kedua terhadap kestabilan p53 dengan secara langsung memfosforilasi pengatur negatif p53, MDM2, pada S395. 13 Pengubahsuaian ini membenarkan interaksi MDM2/p53, tetapi menghalang eksport nuklear p53 ke sitoplasma di mana degradasi biasanya berlaku. Peranan ATR dalam fosforilasi p53 S20 (dan penstabilan berikutnya) kurang mapan, tetapi tersirat melalui dalam vitro bukti yang menunjukkan fosforilasi S20 oleh kinase yang bergantung kepada ATR, Chk1. 14

Walaupun fosforilasi S20 adalah penting untuk kestabilan p53, ia adalah fosforilasi S15 yang kelihatan penting dalam meningkatkan aktiviti transaktivasi transkrip p53. 15 Residu S15 p53 dapat difosforilasi secara langsung oleh ATM atau ATR sebagai tindak balas kepada IR (ATM dan ATR), penyinaran UV (ATR) dan gerai garpu replikasi DNA (ATR). P53 yang diaktifkan kemudian mengawal selia beberapa gen sasaran, beberapa daripadanya turut terlibat dalam tindak balas kerosakan DNA (MDM2, GADD45a, dan p21/Cip). Pengumpulan p21, perencat kinase yang bergantung kepada cyclin, menyekat aktiviti kinase Cyclin E/Cdk2 dengan itu mengakibatkan penangkapan G1 (lihat rujukan 10 dan rujukan di dalamnya).

Pusat Pemeriksaan fasa S

Pusat pemeriksaan fasa S memantau perkembangan kitaran sel dan mengurangkan kadar sintesis DNA berikutan kerosakan DNA. Walaupun jalan ini adalah yang paling tidak difahami dari titik pemeriksaan mamalia, kajian baru-baru ini mengenai pengaktifan pusat pemeriksaan fasa-S yang disebabkan oleh IR mulai memberikan pandangan penting. Sel dari individu yang terdedah kepada barah yang terkena ataxia telangiectasia (AT) atau sindrom pecah Nijmegen (NBS) gagal memperlambat kadar replikasi DNA mereka berikutan pendedahan IR pada fenomena yang dikenali sebagai sintesis DNA tahan radio (RDS). Penemuan ini membabitkan produk gen yang berkaitan (ATM dan NBS1, masing-masing) dalam laluan pemeriksaan fasa S. Bukti eksperimen menunjukkan bahawa kerosakan IR mengaktifkan pusat pemeriksaan fasa-S melalui sekurang-kurangnya 2 cawangan selari, yang kedua-duanya dikawal oleh ATM. 16, 17, 18 Dalam cawangan pertama, kerosakan IR mendorong fosforilasi kinase Chk2 (pada T68) oleh ATM. 19 Chk2, setelah diaktifkan, menyasarkan fosfatase Cdc25A untuk degradasi yang bergantung kepada ubiquitin dengan memfosforilasinya pada S123. 19 Ketidakstabilan Cdc25A yang terhasil menghalangnya daripada menjalankan fungsi normalnya untuk menghilangkan fosforilasi penghambat (T14 dan Y15) dari Cdk2. Kompleks Cdk2/Cyclin E dan Cdk2/Cyclin A kekal tidak aktif sekali gus menghalang penyiapan sintesis DNA.

Cawangan kedua laluan pusat pemeriksaan fasa S yang disebabkan oleh IR adalah bebas daripada Cdc25A, tetapi memerlukan aktiviti kedua-dua ATM dan NBS1. 16, 17, 18 Setelah kerosakan IR, ATM fosforilasi sejumlah substrat hilir termasuk NBS1 (di beberapa laman web termasuk S343), produk gen kerentanan kanser payudara 1 (BRCA1 di beberapa laman web termasuk S1387), dan SMC1 (penyelenggaraan struktur protein kromosom 1 pada S957 dan S966). Kehilangan mana-mana protein ini atau mutasi tapak fosforilasi yang ditunjukkan mengakibatkan pengaktifan pusat pemeriksaan fasa S yang dilemahkan. 16, 17, 18, 20 Menariknya, protein NBS1 dan BRCA1 diperlukan untuk fosforilasi optimum SMC1 pada IR, 17, 18 mungkin menunjukkan bahawa kompleks protein yang lebih besar mesti dibentuk sebelum ATM boleh memfosforilasi SMC1. Sebenarnya, protein ATM, NBS1, dan BRCA1 telah terbukti menjadi sebahagian daripada kompleks protein bersaiz mega-dalton yang disebut sebagai BASC (kompleks pengawasan genom berkaitan BRCA1) yang juga merangkumi banyak faktor pembaikan dan replikasi DNA yang lain. 21 Peranan tepat protein ini, dan butiran mekanistik tentang bagaimana pengaktifan cawangan pusat pemeriksaan fasa-S ini membawa kepada pengurangan sintesis DNA masih perlu dijelaskan.

Penglibatan ATR di pusat pemeriksaan fasa-S juga masih tidak jelas. ATR telah ditunjukkan untuk memulakan tindak balas titik pemeriksaan fasa-S yang disebabkan oleh IR yang lambat dengan fosforilasi kinase pengaruhnya, Chk1 (pada S317 dan S345), yang pada gilirannya fosforilasi Cdc25A menargetkannya untuk degradasi. 22 Di samping itu, SMC1 menjalani fosforilasi S957 dan S966 selepas penyinaran UV atau rawatan hidroksiurea dalam cara bebas ATM. 18 Responsif ATR yang ditunjukkan kepada kerosakan UV dan blok replikasi menjadikannya suspek utama dalam fosforilasi SMC1 di bawah keadaan ini, bagaimanapun, bukti eksperimen kurang. Selanjutnya, laluan pemeriksaan S-fasa yang diarahkan ATR tambahan untuk menangani kerosakan UV dan kesalahan replikasi telah dilaporkan. 7

G2 Checkpoint

Pusat pemeriksaan kitaran sel G2 ialah langkah kawalan penting yang membenarkan penggantungan kitaran sel sebelum pengasingan kromosom. Kemasukan ke mitosis dikawal oleh aktiviti kinase Cdc2 yang bergantung pada siklin. 23 Penyelenggaraan fosforilasi perencatan pada Cdc2 (pada T14 danY15) adalah penting untuk pengaktifan pusat pemeriksaan G2. ATM dan ATR secara tidak langsung memodulasi status fosforilasi tapak ini sebagai tindak balas kepada kerosakan DNA. Tidak seperti pusat pemeriksaan lain, tindak balas kepada IR dimediasi terutamanya oleh ATR 24 dengan ATM memainkan peranan sandaran, tindak balas terhadap kerosakan UV dan blok replikasi dikawal oleh ATR. Perlu diingatkan bahawa peringkat kitaran sel apabila kerosakan DNA berlaku mungkin mempengaruhi sama ada tindak balas dimediasi melalui ATR atau ATM. 7 Dalam sebarang kes, apabila kerosakan DNA, kinase hiliran Chk1 dan Chk2 (masing-masing diaktifkan oleh fosforilasi bergantung ATR dan ATM) memfosforilasi fosfatase kekhususan dwi Cdc25C pada kedudukan S216. 25 Fosforilasi residu ini membentuk laman pengikat untuk protein 14-3-3. Kompleks protein 14-3-3 / Cdc25C diasingkan dalam sitoplasma, sehingga mencegah Cdc25C mengaktifkan Cdc2 melalui penyingkiran fosforilasi penghambatan T14 dan Y15. Ini mengakibatkan pengekalan kompleks Cdc2/Cyclin B1 dalam keadaan tidak aktif dan sekatan kemasukan ke dalam mitosis.

Laluan Pembaikan DNA

Pembalikan Langsung Laluan pembaikan DNA manusia yang paling mudah melibatkan pembalikan langsung lesi alkilasi sangat mutagenik O 6 -methylguanine (O 6 -mG) oleh produk gen MGMT (O 6 -methylguanine DNA methyltransferase). 26 Penambahan O 6 -mG dijana dalam tahap rendah melalui tindak balas katabolit selular dengan sisa guanin dalam DNA. Pembetulan lesi berlaku dengan pemindahan langsung kumpulan alkil pada guanin ke residu sistein di tempat aktif MGMT dalam reaksi "bunuh diri". Protein alkil-MGMT yang tidak aktif kemudiannya terdegradasi dalam laluan proteolitik ubiquitin yang bergantung kepada ATP. 28 Mekanisme pembaikan yang sangat mahal ini untuk pembetulan penambahan alkil yang agak sederhana menunjukkan O 6-mG sangat merugikan sel. Sehubungan itu, beberapa agen kemoterapi yang menyerang kedudukan O 6 guanin telah dibangunkan dan sedang digunakan secara klinikal. 29

BER Pembaikan pengasingan asas (BER) ialah proses berbilang langkah yang membetulkan kerosakan bukan besar pada bes akibat daripada pengoksidaan, metilasi, deaminasi atau kehilangan spontan asas DNA itu sendiri. 30 Perubahan ini, walaupun sifatnya mudah, adalah sangat mutagenik dan oleh itu mewakili ancaman ketara kepada kesetiaan dan kestabilan genom. 2


Lihat Imej Lebih Besar
Gambar 3. Pembaikan Excision Base (BER). Ditunjukkan ialah model umum laluan BER patch pendek (kiri) dan patch panjang (kanan). Pembaikan patch pendek menggantikan lesi dengan pembaikan patch nukleotida panjang menggantikan lesi dengan kira-kira 2 hingga 10 nukleotida. Lihat teks utama untuk maklumat tambahan.

BER mempunyai dua sublaluan (Rajah 3), kedua-duanya dimulakan oleh tindakan glikosilase DNA yang memecahkan ikatan N-glikosidik antara bes yang rosak dan tulang belakang gula fosfat DNA. Pembelahan ini menghasilkan laman web apyrimidinic / apurinic (AP) atau abasik dalam DNA. Lapan glikosilase DNA dengan kekhususan tambahan asas yang tumpang tindih telah dikenal pasti pada manusia. 31 Sebagai alternatif, tapak AP juga boleh timbul oleh hidrolisis spontan ikatan N-glikosidik. Dalam kedua-dua kes tersebut, laman AP kemudiannya diproses oleh AP Endonuclease 1 (APE1) yang memotong tulang belakang fosfodiester segera 5 'ke laman AP, menghasilkan gugus hidroksil 3' dan fosfat abasik deoksiribosa 5 'sementara (dRP). Penyingkiran dRP boleh dicapai dengan tindakan DNA polimerase beta (Pol b), yang menambahkan satu nukleotida pada hujung 3' samaran dan menghilangkan bahagian dRP melalui aktiviti AP lyase yang berkaitan. 32 Tali samaran akhirnya dimeterai oleh ligase DNA, sekali gus memulihkan integriti DNA. Penggantian asas yang rosak dengan satu nukleotida baru seperti yang dijelaskan di atas disebut sebagai perbaikan "patch pendek" dan mewakili sekitar 80-90% dari semua BER.

Jalur sokongan BER, yang disebut "pembaikan panjang", digunakan apabila pangkalan yang diubah suai terhadap aktiviti lyase AP DNA Pol beta terdapat di dalam DNA. 33 Pembaikan tampalan panjang menghasilkan penggantian kira-kira 2-10 nukleotida termasuk tapak yang rosak. Laluan bawah tanah ini memerlukan banyak faktor yang sama yang terlibat dalam pembaikan jalan pintas, termasuk DNA glikosilase, APE1 dan DNA Pol beta. Tidak seperti pembaikan patch pendek, bagaimanapun, pembaikan long-patch adalah jalan yang bergantung pada PCNA, 34 di mana DNA polimerase (beta d, zeta r epsilon) menambahkan beberapa nukleotida ke jurang pembaikan sehingga menggeser dRP sebagai bagian dari "flap" oligonukleotida. Oligonukleotida yang tidak terhasil dikeluarkan oleh Flap endonuclease FEN-1 sebelum pengedap samaran oleh ligase DNA.

NER Pembaikan eksisi nukleotida (NER) mungkin merupakan laluan pembaikan DNA yang paling fleksibel memandangkan kepelbagaian lesi DNA yang bertindak atasnya. Lesi yang paling ketara adalah dimer pyrimidine (dimer cyclobutane pyrimidine dan 6-4 photoproducts) yang disebabkan oleh komponen sinar matahari UV. Substrat NER lain termasuk bahan kimia tambahan, pautan silang intrastrand DNA, dan beberapa bentuk kerosakan oksidatif. Ciri-ciri biasa lesi yang diiktiraf oleh laluan NER ialah ia menyebabkan herotan heliks dupleks DNA dan pengubahsuaian kimia DNA. 35

Wawasan yang cukup besar mengenai proses NER manusia telah diperoleh melalui kajian dua gangguan resesif autosom, tetapi heterogen yang jarang berlaku - xeroderma pigmentosum (XP) dan Cockayne Syndrome (CS). Individu yang terkena salah satu daripada penyakit ini menunjukkan hipersensitiviti UV yang teruk. Kedua-dua penyakit secara genetik heterogen XP disebabkan oleh mutasi dalam salah satu daripada tujuh gen (XPA ke XPG) dan CS disebabkan oleh kecacatan pada salah satu daripada dua gen (CSA atau CSB). Produk gen XP kini diketahui dapat menjalankan pelbagai fungsi semasa pengecaman kerosakan dan pemotongan DNA. 36 Produk gen CS, sebaliknya, diperlukan untuk pembaikan berasaskan NER bagi gen aktif transkripsi. 37


Lihat Imej Lebih Besar
Gambar 4. Pembaikan Eksisi Nukleotida (NER). Model langkah yang dipermudahkan dalam NER ditunjukkan. Pengecaman kerosakan DNA (1) berbeza antara genetik global dan transkripsi NER (GG- dan TC-NER, masing-masing). Langkah-langkah berikutnya dari proses-proses ini dikongsi bersama dan merangkumi penyingkiran DNA (2), insisi ganda untai DNA (3), dan sintesis pembaikan DNA dan ligasi helai (4). Lihat teks utama untuk butiran tambahan.

Proses NER memerlukan tindakan lebih daripada 30 protein secara bertahap yang merangkumi pengecaman kerosakan, pembukaan lokal dupleks DNA di sekitar lesi, pemotongan ganda helai DNA yang rosak, sintesis pembaikan jurang, dan ligasi helai (Gambar 4). 38 Seperti yang disebutkan di atas, terdapat dua bentuk NER yang berbeza: NER genomik global (GG-NER), yang membetulkan kerosakan di kawasan genom yang diam secara transkripsi, dan NER yang digabungkan dengan transkripsi (TC-NER), yang memperbaiki lesi pada transkrip yang aktif. untaian DNA. Kedua-dua sub-jalan ini pada dasarnya sama kecuali dalam mekanisme pengiktirafan kerosakannya. Di GG-NER, kompleks protein XPC / HHR23B bertanggungjawab untuk pengesanan awal DNA yang rosak. Sebaliknya, pengecaman kerosakan semasa TC-NER tidak memerlukan XPC, sebaliknya dianggap berlaku apabila jentera transkripsi terhenti di tapak kecederaan. Kompleks polimerase RNA yang terhenti kemudian mesti dipindahkan untuk membolehkan protein NER masuk ke DNA yang rosak. Anjakan ini dibantu oleh tindakan protein CSA dan CSB, serta faktor khusus TC-NER yang lain. Langkah-langkah seterusnya GG- dan TC-NER diteruskan dengan cara yang pada asasnya sama. XPA dan protein replikasi heterotrimerik A (RPA) kemudian mengikat di tapak kecederaan dan seterusnya membantu dalam pengecaman kerosakan. Seterusnya, helicases XPB dan XPD, komponen faktor transkripsi multi-subunit TFIIH, melepaskan dupleks DNA di sekitar lesi. Endonuclease XPG dan ERCC1/XPF kemudian membelah satu helai DNA pada kedudukan 3' dan 5' masing-masing kepada kerosakan, menghasilkan kira-kira 30 asas oligonukleotida yang mengandungi lesi. Oligonukleotida ini dialihkan, memberi laluan kepada sintesis pembaikan jurang (dilakukan oleh DNA Pol delta epsilon, serta beberapa faktor aksesori replikasi). Akhirnya, julukan pada helai yang diperbaiki dimeteraikan oleh ligase DNA, sehingga menyelesaikan proses NER.

MMR Laluan pembaikan ketidakpadanan DNA (MMR) memainkan peranan penting dalam pembetulan ralat replikasi seperti ketidakpadanan asas asas dan gelung sisipan/padaman (IDL) yang terhasil daripada salah penggabungan DNA polimerase nukleotida dan gelinciran templat. Kesalahan yang dihasilkan oleh deaminasi spontan 5-methylcytosine dan heteroduplexes yang terbentuk berikutan pengumpulan semula genetik juga diperbetulkan melalui MMR. Kecacatan pada jalan ini menghasilkan fenotip selular yang disebut "mutator" yang dicirikan oleh peningkatan frekuensi dalam mutasi spontan dan peningkatan ketidakstabilan mikrosatelit (MSI). Mutasi dalam beberapa gen MMR manusia menyebabkan kecenderungan kepada karsinoma kolorektal nonpoliposis keturunan (HNPCC), serta pelbagai tumor sporadis yang memaparkan MSI. 5

Keseluruhan proses MMR serupa dengan jalur pembaikan eksisi yang lain (lihat BER-patch panjang, dan NER), di mana lesi DNA (ketidakcocokan atau IDL) dikenali, tambalan yang mengandung lesi dipotong, dan helai diperbaiki oleh sintesis pembaikan DNA dan re-ligasi (Rajah 5). 39 Laluan MMR mamalia dimulakan dengan pengecaman ketidakpadanan atau IDL oleh heterodimer protein MSH2-MSH6 (dikenali sebagai MutS alpha beta). Aktiviti ketidakseimbangan asas-asas yang dominan dan IDL asas tunggal dalam sel manusia disediakan oleh MutS alpha 40 IDL yang lebih besar biasanya dikenali oleh MutS beta. Walau bagaimanapun, terdapat beberapa pertindihan separa dalam kekhususan substrat oleh kedua-dua heterodimer ini menunjukkan sekurang-kurangnya tahap redundansi minimum dalam pengecaman substrat oleh laluan MMR. 40 Berikutan pengenalpastian lesi, MutS alpha beta) mengikat ATP, mengalami anjakan konformasi, dan translokasi sepanjang DNA dari tapak lesi sehingga protein MMR tambahan ditemui. 41, 42 Kompleks protein peringkat tinggi terbentuk, termasuk yang mengandungi protein heterodimerik MLH1-PMS2 (MutL alpha beta), MLH1-MLH3, dan faktor replikasi. Diskriminasi strand dianggap berlaku oleh hubungan protein MMR dengan mesin replikasi. 43 Sokongan hipotesis ini disediakan oleh penemuan bahawa alfa MutL boleh berinteraksi dengan faktor aksesori replikasi, PCNA. 44 Interaksi ini mungkin memberikan hubungan fizikal antara pengecaman ketidakpadanan dan pengenalpastian untaian DNA yang baru disintesis pada garpu replikasi. Eksisi dan resynthesis helai yang baru lahir (mengandungi ketidakcocokan atau IDL) dilakukan oleh beberapa faktor termasuk PCNA, RPA, RFC, exonuclease I, DNA polimerase delta dan epsilon, endonuclease FEN1, dan faktor tambahan. 43


Lihat Imej Lebih Besar
Gambar 5. Pembaikan Ketidaksesuaian (MMR). Model MMR DNA mamalia ditunjukkan. MMR dimulakan oleh pengiktirafan tidak sepadan dan diskriminasi helai. Berikutan pemotongan helai yang baru disintesis yang mengandungi asas yang tidak sepadan atau gelung sisipan/pemadaman (IDL), sintesis semula helai dilakukan untuk memulihkan kesetiaan DNA.

Pembaikan DSB Pecah dua helai (DSB) mungkin merupakan bentuk kerosakan DNA yang paling serius kerana ia menimbulkan masalah untuk transkripsi, replikasi dan pengasingan kromosom. Kerosakan jenis ini disebabkan oleh pelbagai sumber termasuk agen eksogen seperti sinaran mengion dan bahan kimia genotoksik tertentu, spesies oksigen reaktif yang dijana secara endogen, replikasi pecahan DNA beruntai tunggal, dan tekanan mekanikal pada kromosom. DSB berbeza daripada kebanyakan jenis lesi DNA lain kerana ia menjejaskan kedua-dua helai dupleks DNA dan oleh itu menghalang penggunaan helai pelengkap sebagai templat untuk pembaikan (lihat BER, NER, dan MMR). Kegagalan untuk membaiki kecacatan ini boleh mengakibatkan ketidakstabilan kromosom yang membawa kepada ekspresi gen yang tidak terkawal dan karsinogenesis. 4 Untuk mengatasi kesan buruk daripada lesi yang kuat ini, sel telah mengembangkan dua laluan berbeza untuk pembaikan DSB, 45 penggabungan semula homolog (HR) dan penyambungan hujung bukan homolog (NHEJ) (Rajah 6). Keputusan selular tentang laluan mana yang hendak digunakan untuk pembaikan DSB tidak jelas, bagaimanapun, ia nampaknya dipengaruhi oleh peringkat dalam kitaran sel pada masa pemerolehan kerosakan. 46

Pembaikan yang diarahkan oleh HR membetulkan kecacatan DSB secara bebas dari kesalahan menggunakan mekanisme yang mengambil maklumat genetik dari molekul DNA yang homolog dan tidak rosak. Majoriti pembaikan berasaskan HR berlaku dalam fasa S- dan G2 lewat kitaran sel apabila kromatid kakak yang tidak rosak tersedia untuk digunakan sebagai templat pembaikan. Kumpulan protein RAD52 epistasis, termasuk RAD50, RAD51, RAD52, RAD54, dan MRE11 menengahi proses ini. 47 Protein RAD52 itu sendiri dianggap sebagai sensor awal ujung DNA yang pecah. Pemprosesan hujung yang rosak seterusnya menghasilkan pengeluaran 3' rantaian tunggal DNA (ssDNA) tidak terjual. Hujung ssDNA yang baru dihasilkan diikat oleh RAD51 untuk membentuk filamen nukleoprotein. Protein lain termasuk RPA, RAD52, RAD54, BRCA1, BRCA2, dan beberapa protein berkaitan RAD51 tambahan berfungsi sebagai faktor aksesori dalam pemasangan filamen dan aktiviti RAD51 berikutnya. 45 Filamen nukleoprotein RAD51 kemudiannya mencari DNA yang tidak rosak pada kromatid kakak untuk mendapatkan templat pembaikan homolog. Sebaik sahaja DNA homolog dikenal pasti, untai DNA yang rosak menyerang dupleks DNA yang tidak rosak dalam proses yang dirujuk sebagai pertukaran untai DNA. Polimerase DNA kemudian memanjangkan hujung 3' untaian penceroboh dan pengikatan seterusnya oleh DNA Ligase I menghasilkan struktur DNA heterodupleks. Perantaraan penggabungan ini diselesaikan dan pembetulan DSB yang tepat dan bebas ralat selesai.


Lihat Imej Lebih Besar
Gambar 6. Pembaikan Double Strand Break (DSB). Ditunjukkan ialah gambaran keseluruhan langkah-langkah utama dan keperluan faktor untuk pembaikan DSB DNA oleh penggabungan semula homolog (kiri) dan penyambungan akhir tidak homolog (kanan). Lihat teks utama untuk butiran.

Berbeza dengan HR, NHEJ tidak memerlukan templat homolog untuk pembaikan DSB dan biasanya menghasilkan pembetulan rehat dengan cara ralat. Penting untuk laluan NHEJ adalah aktiviti protein heterodimerik Ku70 / Ku80. 48 Heterodimer Ku memulakan NHEJ dengan mengikat pada hujung DNA bebas dan merekrut faktor NHEJ lain seperti kinase protein yang bergantung kepada DNA (DNA-PK), XRCC4, dan DNA Ligase IV ke tapak kecederaan. 45 DNA-PK menjadi aktif setelah pengikatan DNA, dan fosforilasi sejumlah substrat termasuk p53, Ku, dan kofaktor DNA Ligase IV XRCC4. Fosforilasi faktor-faktor ini dipercayai dapat mempermudah proses pembaikan. Oleh kerana hujung kebanyakan DSB yang dihasilkan oleh agen genotoksik rosak dan tidak dapat diikat secara langsung, ia selalunya perlu menjalani pemprosesan terhad oleh nuklease dan/atau polimerase sebelum NHEJ boleh diteruskan. Nuklease(s) yang bertanggungjawab untuk pemprosesan ini masih belum ditentukan, tetapi calon yang kuat untuk aktiviti ini termasuk kompleks MRE11/Rad50/NBS1, 49, 50 FEN-1, 51 dan protein Artemis. 52 Langkah terakhir dalam pembaikan NHEJ melibatkan pengikatan DNA yang diakhiri oleh Ligase IV dalam kompleks yang turut merangkumi XRCC4 dan Ku.


Pembaikan Pemecatan Asas dan Pembaikan Pemecatan Nukleotida

Pembaikan eksisi asas (BER) melibatkan pelbagai enzim untuk mengeluarkan dan menggantikan satu asas nukleotida yang rosak. Pengubahsuaian asas yang terutama diperbaiki oleh enzim BER adalah yang rosak oleh pengoksidaan dan hidrolisis endogen. Glikosilase DNA memutuskan ikatan antara bes nukleotida dan ribosa, meninggalkan rantaian fosfat ribosa DNA utuh tetapi menghasilkan tapak apurinik atau apyrimidin (AP). 8-Oxoguanine DNA glycosylase I (Ogg1) mengeluarkan 7,8-dihydro-8-oxoguanine (8-oxoG), salah satu mutasi asas yang dihasilkan oleh spesies oksigen reaktif. Polimorfisme dalam gen OGG1 manusia dikaitkan dengan risiko pelbagai jenis kanser seperti kanser paru-paru dan prostat. Uracil DNA glycosylase, satu lagi enzim BER, mengeluarkan urasil yang merupakan hasil deaminasi sitosin, dengan itu menghalang mutasi titik C→T berikutnya. 15 N-Methylpurine DNA glycosylase (MPG) mampu mengeluarkan pelbagai asas purin yang diubah suai. 16

The AP sites in the DNA that result from the action of BER enzymes, as well as those that result from depyrimidination and depurin ation actions, are repaired by the action of AP-endonuclease 1 (APE1). APE1 cleaves the phosphodiester chain 5’ to the AP site. The DNA strand then contains a 3’-hydroxyl group and a 5’-abasic deoxyribose phosphate. DNA polymerase β (Polβ) inserts the correct nucleotide based on the corresponding W-C pairing and removes the deoxyribose phosphate through its associated AP-lyase activity. The presence of X-ray repair cross-complementing group 1 (XRCC1) is necessary to form a heterodimer with DNA ligase III (LIG3). XRCC1 acts as a scaffold protein to present a non-reactive binding site for Polβ, and bring the Polβ and LIG3 enzymes together at the site of repair. 17 Poly(ADP-ribose) polymerase (PARP-1) interacts with XRCC1 and Polβ and is a necessary component of the BER pathway. 18,19 The final step in the repair is performed by LIG3, which connects the deoxyribose of the replacement nucleotide to the deoxyribosylphosphate backbone. This pathway has been named “short-patch BER”. 20

An alternative pathway called “long-patch BER” replaces a strand of nucleotides with a minimum length of 2 nucleotides. Repair lengths of 10 to 12 nucleotides have been reported. 21,22 Longpatch BER requires the presence of proliferation cell nuclear antigen (PCNA), which acts as a scaffold protein for the restructuring enzymes. 23 Other DNA polymerases, possibly Polδ and Polε, 24 are used to generate an oligonucleotide flap. The existing nucleotide sequence is removed by flap endonuclease-1 (FEN1). The oligonucleotide is then ligated to the DNA by DNA ligase I (LIG1), sealing the break and completing the repair. 17 The process used to determine the selection of short-patch versus long patch BER pathways is still under investigation (Gambar 4). 25

Gambar 4. Schematic of both short-patch and long-patch BER pathways.

While BER may replace multiple nucleotides via the long-patch pathway, the initiating event for both short-patch and long-patch BER is damage to a single nucleotide, resulting in minimal impact on the structure of the DNA double helix. Nucleotide excision repair (NER) repairs damage to a nucleotide strand containing at least 2 bases and creating a structural distortion of the DNA. NER acts to repair single strand breaks in addition to serial damage from exogenous sources such as bulky DNA adducts and UV radiation. 26 The same pathway may be used to repair damage from oxidative stress. 27 Over 20 proteins are involved in the NER pathway in mammalian cells, including XPA, XPC-hHR23B, replication protein A (RPA), transcription factor TFIIH, XPB and XPD DNA helicases, ERCC1-XPF and XPG, Polδ, Polε, PCNA, and replication factor C. 28 Overexpression of the excision repair cross-complementing (ERCC1) gene has been associated with cisplatin resistance by non-small-cell lung cancer cells 29 and corresponds to enhanced DNA repair capacity. 30 Global genomic NER (GGR) repairs damage throughout the genome, while a specific NER pathway called Transcription Coupled Repair (TCR) repairs genes during active RNA polymerase transcription. 31


Maklumat pengarang

Gabungan

IFOM, The FIRC Institute of Molecular Oncology, Milan, Italy

Fabio Pessina, Ubaldo Gioia, Valerio Vitelli, Alessandro Galbiati, Sara Barozzi, Massimiliano Garre, Amanda Oldani, Dario Parazzoli & Fabrizio d’Adda di Fagagna

Dipartimento di Biotecnologie Mediche e Medicina Traslazionale, Università degli Studi di Milano, Segrate, Italy

Fabio Giavazzi & Roberto Cerbino

Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY, USA

Yandong Yin & Eli Rothenberg

Centre for Chromosome Biology, Biochemistry, School of Natural Sciences, National University of Ireland, Galway, Ireland

Istituto di Genetica Molecolare, CNR—Consiglio Nazionale delle Ricerche, Pavia, Italy

Fabrizio d’Adda di Fagagna

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Anda juga boleh mencari penulis ini di PubMed Google Scholar

Sumbangan

F.G. conceived and performed all of the LLPS analyses of 53BP1 foci. Y.Y. performed all of the STORM experiments. U.G., together with M.G., performed timelapse experiments of 53BP1 foci treated with NH4OAc and 1,6-hexanediol, and performed comet assays and the EJ5 repair assays. V.V. conceived and performed strand-specific RT–qPCR and qPCR analysis of ChIP experiments and dilncRNA detection both in cells and in vitro. A.G. conceived and performed DIPLA analysis. S.B. performed all of the microinjections in cells and all of the 53BP1 droplets detection experiments in vitro. M.G. performed all of the timelapse experiments assisted by U.G. F.P. performed all of the FRAP experiments and confocal analysis of 53BP1 focus formation. A.O. performed all of the quantifications of confocal images. A.F. supervised F.P. for the in vitro system and nucleosome preparation and edited the manuscript. R.C. advised F.G. and edited the manuscript. D.P. supervised S.B., M.G. and A.O. and advised them on all of the imaging experiments. E.R. supervised Y.Y. and edited the manuscript. F.P. designed and performed all of the remaining experiments and wrote the manuscript. F.d’A.d.F. conceived the study and, together with F.P., assembled and revised the manuscript. All of the authors commented on the manuscript.

Pengarang sama


KEPUTUSAN

RCC1 overexpression accelerates the cell cycle

The cellular concentration of free Ran⋅GTP available for binding to NTRs is critical for most known Ran-regulated functions, including NCT. To determine changes in Ran regulation that could lead to increased Ran⋅GTP levels, we applied computational modeling of the minimal set of proteins controlling the GTP/GDP cycle on Ran. Within these models, we either increased or decreased the concentrations of their individual components and followed the changes of average cellular Ran⋅GTP concentration (Gorlich et al., 2003 Caudron et al., 2005 Kalab et al., 2006). The NCT rates for all Ran system components are not known. Therefore we used the previously published single-compartment models of mitotic HeLa cells (Caudron et al., 2005 Kalab et al., 2006) to simulate the Ran system in rapidly dividing mitotic cells with high Ran⋅GTP levels (Hasegawa et al., 2013 Figure 1B). From the relative expression in HeLa and human fibroblasts (HFF-1 Supplemental Figure S1), we deduced the composition of the Ran system in slowly dividing cells (Hasegawa et al., 2013 Figure 1A, Supplemental Figure S1, Supplemental Text S1, and Supplemental Tables S1 and S2). In both models, Ran⋅GTP levels were most responsive to simultaneous changes in Ran and RCC1 concentrations and reduced RanGAP1 expression (Figure 1, A and B). When overexpression of individual factors was considered, Ran⋅GTP was most sensitive to RCC1 concentration in the fibroblast model (Figure 1A) and to changes in Ran in the HeLa model (Figure 1B). Therefore, to examine how increased Ran⋅GTP levels affect the cell cycle in relatively slowly dividing cells, we tested RCC1 overexpression.

FIGURE 1: RCC1-dependent increase in Ran⋅GTP accelerates the cell cycle. (A and B) Changes in cellular Ran⋅GTP concentration analyzed by computational models of the minimal Ran system in a fibroblast-like cell (A) and a HeLa-like cell (B). (C) Immunoblots of RCC1 in the hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cell lysates. (D) Schematic of the RBP-4 FRET sensor for Ran⋅GTP detection with FLIM. The binding of Ran⋅GTP to RBP-4 increases the donor–acceptor distance, resulting in a longer donor fluorescence lifetime, τpenderma. (E) Detection of mitotic Ran⋅GTP gradients in hTERT-RPE1 WT and hTERT-ΔRPE1 RCC1-V5 cells, using FLIM with RBP-4. The top row shows the donor intensity images and the bottom row shows the pseudocolor FLIM images. The range of the displayed values (corresponding to τpenderma values) is indicated beneath the FLIM panels. Scale bar: 10 μm. (F) Scatter plot of the mitotic Ran⋅GTP gradients quantified as the difference between the cytoplasmic and chromatin E in each cell (ΔE single-cell data means ± SD t ujian). (G) Scatter plot of the inverse of the average cellular RBP-4 E, which is proportional to Ran⋅GTP concentration (E −1 single-cell data means ± SD t ujian). (H) Cell number in cultures of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells grown in parallel. Means ± SD from two experiments performed in triplicate were fitted with exponential growth equations after 2 d from the start of culture (dashed lines) to calculate the PDT. The null hypothesis was tested: one curve for both data sets.

We chose the telomerase-immortalized normal epithelial RPE1 cells (hTERT-RPE1 WT ) as a model, because these cells display intermediate mitotic Ran⋅GTP gradients and Ran⋅GTP levels (Hasegawa et al., 2013). Because the models predicted that the effect of RCC1 on Ran⋅GTP would saturate at low micromolar RCC1 concentrations (Supplemental Figure S1), we selected human phosphoglycerate kinase (PGK) promoter to drive moderate overexpression of RCC1 with a C-terminal V5 tag in a stable hTERT-RPE1 RCC1-V5 cell line. From immunoblots (Figure 1C), we estimated that the total RCC1 concentration in the hTERT-RPE1 RCC1-V5 cells was four to six times higher than in the hTERT-RPE1 WT cells. Such an increase in RCC1 levels was similar to the difference between HFF-1 and HeLa cells (Figure 1, A and B, and Supplemental Figure S1), suggesting that the RCC1 overexpression mimicked the physiologically relevant range. We then verified the effect of RCC1 overexpression using RBP-4, the Förster resonance energy transfer (FRET) biosensor for Ran⋅GTP in mitotic cells (Hasegawa et al., 2013). RBP-4 consists of a Ran⋅GTP-binding domain flanked by the cyan mTFP-1 donor and a nonfluorescent dsREACh acceptor (Figure 1D Hasegawa et al., 2013). RBP-4 binding to Ran⋅GTP extends the donor from the acceptor, leading to decreased FRET efficiency (E RBP-4 ) and increased donor fluorescence lifetime (τpenderma). Because the RBP-4 FRET activity decreases with Ran⋅GTP binding, the average (E RBP-4 ) −1 value could be used to compare the Ran⋅GTP concentration between different mitotic cells quantitatively (Hasegawa et al., 2013). We applied fluorescence lifetime imaging microscopy (FLIM) to detect the changes of E RBP-4 in live mitotic cells transiently expressing the RBP-4 sensor. The mitotic hTERT-RPE1 RCC1-V5 cells displayed larger differences in E RBP-4 between the chromatin and cytoplasmic areas (Figure 1F) and higher (E RBP-4 ) −1 values (Figure 1G), confirming the expected increased mitotic Ran⋅GTP gradients and elevated Ran⋅GTP levels. The compartmentalization of Ran and its regulators RCC1 and RanGAP1 between the nucleus and cytoplasm precludes the direct measurements of Ran⋅GTP with RBP-4 FRET in interphase cells. However, previous studies showed that the expression of Ran, RCC1, and RanGAP1 remained stable during the exit from mitosis (Ciciarello et al., 2010), indicating that the mitotic Ran⋅GTP levels correspond to the Ran⋅GTP-generating activity in the interphase cells as well. Fluorescence-activated cell sorting (FACS) analysis showed that the fraction of cells in different cell cycle phases was not appreciably affected by RCC1 overexpression (Supplemental Figure S1). However, consistent with our initial hypothesis, the hTERT-RPE1 RCC1-V5 cells proliferated significantly faster than the WT cells (Figure 1H population doubling time [PDT] = 2.9 vs. 4.5 d).

Ran⋅GTP levels decline in nondividing cells

If the RCC1-dependent rise of Ran⋅GTP activates cell cycle progression, stimuli inducing cell cycle arrest should oppose RCC1 by lowering its activity or expression. To test this scenario, we induced cell cycle arrest in HFF-1 fibroblasts by a long-term in vitro culture or by inducing DNA damage through treatment with doxorubicin (Chang et al., 2002 Sliwinska et al., 2009). Both replicative exhaustion and doxorubicin treatment induced the onset of cell senescence, as indicated by the appearance of the senescence-associated β-galactosidase (SABG) staining (Debacq-Chainiaux et al., 2009 Figure 2C) and led to a strong decline in RCC1 expression (Figure 2B). We also observed lower Ran and RanBP1 levels in senescent HFF-1 cells and a decrease in RCC1 levels in doxorubicin-treated Wi-38 and CRL-1474 primary human fibroblasts (Supplemental Figure S2). Quantification of immunoblots showed that, when normalized to the total cell protein concentration, the senescent HFF-1 cells contained ∼25% RCC1 compared with early-passage cells (Figure 2B). However, because of their nearly three-times larger volume (1.27 ± 0.07 pl, passage 8 vs. 3.57 ± 0.30 pl, passage 30 HFF-1 fibroblasts), the late-passage cells contained <10% RCC1 concentration compared with the early-passage cells, confirming the strong reduction in the RCC1-dependent Ran⋅GTP generation in nondividing cells.

FIGURE 2: RCC1 expression declines during cell cycle arrest. (A) Immunoblotting of total cell lysates of HFF-1 cells harvested from early (p 8) or late (p 30) passages of in vitro culture and of early-passage HFF-1 cells recovering from the treatment with doxorubicin. (B) Relative tubulin-normalized RCC1 protein expression in HFF-1 cells treated as in A (N = 3 means ± SD). (C) Micrographs of HFF-1 cells treated as in A and B and stained for the SABG. Bar skala: 100 μm.

RCC1 overexpression inhibits cell senescence

The cell cycle–promoting activity of RCC1 (Figure 1) indicated that increased RCC1 expression could attenuate DNA damage–induced cell cycle arrest. To test this idea, we compared the responses of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells to doxorubicin treatment. Within the first 2–4 d after doxorubicin washout, most cells stopped dividing in both cultures, as indicated by the disappearance of interphase and mitotic markers (MCM2, Rad51, p-histone H3 [Ser-10] [pS10H3]). At the same time, the increase in cyclin D1 indicated cell cycle arrest (Figure 3A), and the appearance of the SABG signal marked the onset of senescence (Figure 3B). The cyclin D1 levels remained stable, and SABG positivity increased over time in the hTERT-RPE1 WT cells (Figure 3B). In contrast, SABG-negative and proliferating cells gradually prevailed in the hTERT-RPE1 RCC1-V5 cultures (Figure 3B, arrows), concomitant with increased interphase and mitotic markers and the decline in cyclin D1 expression (Figure 3A). The quantitative capillary immunoblotting (Simple Western) analysis confirmed that, 8 d after doxorubicin treatment, hTERT-RPE1 WT cells accumulated cyclin D1, while hTERT-RPE1 RCC1-V5 cells resumed expression of cyclin B1 (Supplemental Figure S3). As in the senescing fibroblasts (Supplemental Figure S2), the expression of Ran decreased to ∼65% in doxorubicin-treated hTERT-RPE1 WT cells (Figure 3A). In contrast, Ran levels slightly increased in the hTERT-RPE1 RCC1-V5 cells exposed to doxorubicin, indicating that RCC1 expression supported Ran stability in cells exposed to DNA damage (Figure 3A). Two months after the doxorubicin treatment, the hTERT-RPE1 RCC1-V5 cells regained normal proliferation, while virtually no dividing cells were detectable in the hTERT-RPE1 WT cell cultures (Figure 3B). To monitor the progress of DNA damage repair, we used immunofluorescence (IF) to quantify the 53BP1 nuclear foci that assemble at the sites of DNA double-strand break repair (Ciccia and Elledge, 2010). Most of the hTERT-RPE1 RCC1-V5 cells had <5 nuclear foci after 8 d of recovery, and mitotic cells were already detectable (Figure 3C). In contrast, the nuclear 53BP1 foci persisted in nearly all doxorubicin-treated hTERT-RPE1 WT cells (Figure 3C). At the same time, 53BP1 strongly accumulated in the cytoplasm of the hTERT-RPE1 WT cells (Figure 3D), indicating delays in the 53BP1 nuclear import, which is Ran⋅GTP- and importin β–dependent (Moudry et al., 2012). It is possible that delays in nuclear import of cargoes other than 53BP1 limited the rate of DNA repair in the WT cells. However, these results strongly suggest that RCC1-dependent activation of NCT contributed to the efficient DNA damage repair and cell cycle reentry in the hTERT-RPE1 RCC1-V5 cells. We observed similar differences in the response of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells to γ-irradiation–induced DNA damage (Supplemental Figure S4), showing that the effects of RCC1 overexpression in doxorubicin-treated cells did not depend on accelerated drug efflux.

FIGURE 3: RCC1 overexpression inhibits DNA damage–induced cell senescence in normal epithelial cells. (A) Immunoblotting of total lysates from the hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells recovering from doxorubicin treatment, showing the resumed expression of the cell cycle markers in the hTERT-RPE1 RCC1-V5 cells. (B) Micrographs of cells treated as in A and stained for SABG. Bar skala: 100 μm. Arrows indicate dividing cells. (C) IF micrographs of γH2AX and 53BP1 staining in hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells recovering from doxorubicin. The arrow indicates a dividing cell. Scale bar: 10 μm. (D) Scatter plot of the cytoplasmic/nuclear ratios of the 53BP1 IF signal at 8 d of recovery from the doxorubicin. Individual cell data means ± SD t test representative of two experiments. (E) Column graph showing fractions of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells that contained the indicated numbers of 53BP1 foci per nucleus during the recovery from doxorubicin treatment. Means ± SD from two independent experiments, adjusted hlm values from two-way analysis of variance (ANOVA) with Sidak’s multiple comparison tests.

RCC1 promotes doxorubicin resistance in colorectal carcinoma cells

Because the overexpression of RCC1 prevented the onset of DNA damage–induced cell senescence in normal cells (Figure 3 and Supplemental Figure S4), RCC1 could play a role in cancer cell resistance to DNA damage. Consistent with this idea, the expression of RCC1 was found to be activated by a superenhancer element in colorectal carcinoma HCT116 cells (Hnisz et al., 2013), which is a well-studied model of resistance to DNA damage–inducing chemotherapy (Chang et al., 2002 Sliwinska et al., 2009). We used several approaches to test the role of RCC1 in HCT116 cells.

First, we compared the effects of doxorubicin on HCT116 WT and an HCT116 RCC1-V5 cell line that stably expressed V5-tagged RCC1 (Figure 4). As previously reported (Chang et al., 2002 Sliwinska et al., 2009) the doxorubicin-treated HCT116 WT cells initially stopped dividing, increased in size, and became SABG-positive (Figure 4A). Small, rapidly dividing, and SABG-negative cells prevailed in the cultures 5–7 d later (Figure 4A, arrows). A transient peak in cyclin D1 expression and a decline in S and G2/M markers (MCM2, pS10H3 Figure 4B, left) indicated a temporary cell cycle arrest. The phenotypic changes induced by doxorubicin in the HCT116 RCC1-V5 cells were similar to those seen in the HCT116 WT cells. However, the shorter duration of cyclin D1 expression and earlier recovery of the S and G2/M markers indicated that the overexpressed RCC1 slightly accelerated cell cycle reentry after DNA damage in the HCT116 RCC1-V5 cell line (Figure 4B).

FIGURE 4: Endogenous RCC1 expression inhibits DNA damage–induced cell senescence in HCT116 colorectal carcinoma cells. (A) Micrographs of HCT116 WT cells recovering from doxorubicin and stained for the SABG. Bar skala: 100 μm. Arrows indicate SABG activity–free cells. (B) Immunoblotting of total lysates from HCT116 WT and HCT116 RCC1-V5 cells recovering from doxorubicin treatment. (C) Scatter plot of the fractions of colony-forming HCT116 WT and HCT116 RCC-V5 cells recovering from doxorubicin. Single-culture data means ± SD from three experiments performed in triplicate t ujian. (D) Immunoblotting of total lysates of HCT116 WT cells treated with control scramble or RCC1-directed RNAi. (E) Scatter plot of the fractions of colony-forming HCT116 WT cells treated with doxorubicin, followed by control or Ran-directed RNAi. Single-culture data means ± SD from two experiments with four replicates each t-test.

We used clonogenic assays to validate the role of RCC1 expression in DNA damage recovery. After doxorubicin treatment, the fraction of colony-forming cells was nearly twice as high in HCT116 RCC1-V5 compared with HCT116 WT cells (Figure 4C), demonstrating that RCC1 overexpression strongly increased cell survival following DNA damage. By analyzing cultures derived from single doxorubicin-treated HCT116 WT cells, we found that rapidly proliferating clones contained RCC1 concentrations similar to the untreated HCT116 cells, in contrast to a slow-proliferating clone (Supplemental Figure S5), indicating that the recovery from DNA damage selects for cells with high RCC1 expression. The requirement for endogenous RCC1 expression in recovery from DNA damage was further confirmed by strongly reduced colony formation in the doxorubicin-treated HCT116 WT cells upon RCC1 knockdown by RNAi (Figure 4E). Based on these results, RCC1 functions as the DNA damage resistance–promoting factor in HCT116 cells, indicating a potential role of RCC1 in tumor cell proliferation in vivo. Indeed, previously reported RNA microarray data sets contained evidence for statistically significantly higher RCC1 expression in ovarian (Scotto et al., 2008), colorectal (Alhopuro et al., 2012), and carboplatin-resistant cervical tumors (Peters et al., 2005), compared with normal tissues (Supplemental Figure S6). Because moderate RCC1 overexpression was sufficient to accelerate cell cycle and DNA damage repair (Figures 1 and 3), relatively small increases in tumor RCC1 could correspond to the activation of Ran pathways restricted to the proliferative fraction of tumor cells.

Ran promotes DNA damage signaling and repair

Apart from accelerating the cell cycle, RCC1 and Ran⋅GTP could support the survival from DNA damage by activating DNA repair. Consistent with the requirement for Ran activity in DNA damage signaling, immunoblotting showed that the knockdown of Ran or RCC1 by RNAi reduced the ATM-dependent phosphorylation of histone H2AX (γH2AX, Ser-139) and KAP1 (Iyengar and Farnham, 2011 p-KAP1, Ser-824) in γ-irradiated hTERT-RPE1 WT cells (Figure 5A). We applied IF in cells that were fixed with paraformaldehyde and co­permeabilized with Triton X-100 to detect changes in the recruitment of 53BP1 to the chromatin, following DNA damage (Jackson and Bartek, 2009). Although the 53BP1 expression was not affected (Figure 5A), both RCC1 and Ran knockdowns significantly reduced the ratio of nuclear 53BP1 and γH2AX signals in the irradiated cells (Figure 5C), indicating defects in 53BP1 association with the DNA damage sites marked by γH2AX signal. The knockdown of Ran had a stronger effect (Figure 5C) and caused the virtual disappearance of 53BP1 foci in a fraction of cells (Figure 5B, arrows). These results indicate that Ran activity is required for the recruitment of 53BP1 to DNA double-strand breaks, which is an essential step for their subsequent repair (Schultz et al., 2000 Callen et al., 2013).

FIGURE 5: Ran-regulated NCT promotes the cellular response to DNA damage. (A) Immunoblotting of total cell lysates of hTERT-RPE1 WT cells treated with control, RCC1-, or Ran-directed RNAi oligos and harvested 1 h after increasing doses of γ-irradiation. Notice the decreased intensity of the p-KAP1 and γH2AX signals in the RCC1 or Ran RNAi-treated cells. (B) IF micrographs of the γ-irradiated (5 Gy) hTERT-RPE1 WT cells showing the reduced 53BP1 recruitment to the chromatin (arrows) upon Ran or RCC1-directed RNAi. (C) Scatter plot of the 53BP1/γH2AX IF signal ratios in cells treated as in B. Individual cell data means ± SD ANOVA with Tukey’s test. (D) IF micrographs of hTERT-RPE1 RCC1-V5 cells pretreated with 40 μM IPZ or 500 nM KPT-330 and fixed 1 h after γ-irradiation (7.5 Gy). The inset shows the p-KAP1 heterochromatin-associated foci (arrow). (E) Immunoblotting of total cell lysates of hTERT-RPE1 WT (top panel) and hTERT-RPE1 RCC1-V5 (bottom) cells treated with 40 μM IPZ or 500 nM KPT-330 and harvested 1 h after increasing doses of γ-irradiation. (F) Quantification of the tubulin-normalized p-KAP1 and γH2AX signals detected on immunoblots of total lysates of cells treated as described and harvested 1 h after the irradiation with 7.5 Gy. Means ± SD from two experiments ANOVA with Tukey’s posttest.

Next we used inhibitors of importin β and exportin 1 to test the role of two major NTRs in DNA damage signaling. To that end, we pretreated cells for 2 h with the exportin 1 inhibitor KPT-330 (Muqbil et al., 2013) or the importin β inhibitor importazole (IPZ Soderholm et al., 2011) and collected samples for IF and immunoblots 1 h after γ-irradiation. IF indicated an increased number of p-KAP1 nuclear foci associated with the heterochromatin in IPZ-treated cells, while KPT-330 treatment had an opposite effect (Figure 5D). Although this trend was reproducible, the frequency of the IPZ-induced p-KAP1 foci varied between experiments. However, consistent with the IF data, immunoblotting showed that treatment with IPZ induced increased p-KAP1 signal upon irradiation, particularly in hTERT-RPE1 RCC1-V5 cells (Figure 5, E and F). Also in agreement with the IF data, KPT-330 caused a strong reduction in p-KAP1 signal and a more moderate decrease in γH2AX signal on immunoblots (Figure 5, E and F). Reciprocal effects of the inhibitors indicate that the interplay between exportin 1– and importin β–regulated NCT modulates the ATM-dependent phosphorylation of KAP1, which has a role in the heterochromatin DNA repair (White et al., 2012).

Because the activation of Ran promotes cell cycle progression (Figure 1), the RNAi knockdowns or inhibitor treatments described above could have induced cell cycle changes that contribute to the observed effects on DNA damage signaling and repair processes. However, the above results demonstrate that, whether directly or also through modulating the cell cycle, the activity of Ran⋅GTP-regulated NCT mechanisms strongly affects essential steps of DDR in cell populations.

RCC1-induced activation of Ran-regulated NCT terminates DDR

The perturbations of DNA damage signaling induced by Ran or RCC1 knockdowns (Figure 5) indicate that the mechanism of RCC1-induced recovery from DNA damage could require high Ran activity during the initial response to the damage. We examined this possibility by manipulating Ran function in cells that already sustained γ-irradiation–induced (10 Gy) DNA damage. First, we followed the irradiation of the hTERT-RPE1 WT cells by transduction with control or RCC1-V5–expressing lentiviruses (Figure 6A). As shown by the strongly reduced expression of S-phase and G2/M markers (MCM2, pS10H3), the majority of irradiated control cells stopped proliferating, as expected. The rise of transiently expressed RCC1-V5 was paralleled by a drop in cyclin D1 levels, and the renewed expression of interphase and mitotic markers (MCM2, pS10H3 Figure 6A), indicating cell cycle reentry. This result showed that the activation of Ran in cells recovering from DNA damage is sufficient to terminate the DDR and enable the continuation of cell proliferation (Figure 5).

FIGURE 6: RCC1-induced activation of NCT promotes the completion of the DNA repair and cell cycle reentry. (A–C) Immunoblots showing the changes of the cell cycle and DDR markers in cells exposed to different treatments after the γ-irradiation (10 Gy). (A) The γ-irradiated hTERT-RPE1 WT cells were transduced with control or RCC1-V5 expressing lentiviruses. (B) The γ-irradiated hTERT-RPE1 RCC1-V5 cells were treated with dimethyl sulfoxide (control) or 500 nM KPT-330. (C) Control or Ran-directed RNAi was applied after the γ-irradiation of the hTERT-RPE1 RCC1-V5 cells. (D) Micrographs of 53BP1 and γH2AX IF staining in the hTERT-RPE1 RCC1-V5 treated as in C. Inset with the enhanced contrast shows the accumulation of the cytoplasmic 53BP1 signal in the Ran RNAi-treated cells (arrows). (E) Scatter plot of the cytoplasmic/nuclear ratios of the 53BP1 IF signal in the control or Ran RNAi-treated cells at 7 d of recovery from the γ-irradiation. Individual cell data means ± SD t test, representative of two experiments. (F) Fractions of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells recovering from γ-irradiation that contained the indicated numbers of 53BP1 foci per nucleus. Means ± SD from two independent experiments two-way ANOVA with Bonferroni’s posttest.

To determine whether RCC1-induced DDR termination requires the function of exportin 1, we treated γ-irradiated hTERT-RPE1 RCC1-V5 cells with KPT-330. The untreated hTERT-RPE1 RCC1-V5 cells returned to cell cycle after irradiation, as shown by the expression of MCM2, pS10H3, and cyclin B1 (Figure 6B). KPT-330 treatment robustly reversed these trends and induced the accumulation of cyclin D1, indicating that DDR termination requires exportin 1– dependent nuclear export.

To verify that Ran mediates RCC1-induced DDR termination, we treated irradiated hTERT-RPE1 RCC1-V5 cells with control or Ran-directed RNAi. As expected, RNAi controls resumed the cell cycle, as indicated by increased pS10H3 signal and reexpression of the Chk1 kinase, whose activity is essential for S-phase progression (Toledo et al., 2013 Figure 6C). The treatment with Ran RNAi in hTERT-RPE1 RCC1-V5 cells reduced Ran levels by ∼50% (Figure 6C). However, even the partial reduction in Ran expression induced severe delays in DNA repair, as shown by the persistence of phosphorylated ATM on immunoblots (Figure 6C) and 53BP1 nuclear foci in cells stained for IF (Figure 6D). Cell cycle arrest was also confirmed by continuously low levels of Chk1 and pS10H3 (Figure 6C). Similar to hTERT-RPE1 WT cells treated with doxorubicin (Figure 3), the irradiated and Ran RNAi-treated hTERT-RPE1 RCC1-V5 cells accumulated 53BP1 in the cytoplasm (Figure 6, D and E). Therefore the reduced nuclear import of large molecular cargoes, such as 53BP1, appears to be a hallmark of cells failing to complete DNA repair as a consequence of insufficient Ran activity. In summary, these results demonstrate that RCC1-dependent activation of Ran-regulated nuclear import and export pathways facilitated the termination of DDR and cell cycle reentry.


How does ionizing radiation affect cells?

When ionizing radiation interacts with a cell, several things can happen:

  1. The radiation could pass through the cell without damaging the DNA.
  2. The radiation could damage the cell’s DNA, but the DNA repairs itself.
  3. The radiation could prevent the DNA from mereplikasi dengan betul.
  4. The radiation could damage the DNA so badly that the cell dies. Ini dipanggil apoptosis. One dead cell is not a big problem. After all, millions of your cells die every day. But if too many cells die at once, the organism could also die.

Bahan dan Kaedah

Generation of Recombinant Sindbis

The coding regions of p16 (Serrano et al., 1993), p21 (Harper et al., 1993), and p27 (Polyak et al., 1994) were subcloned into the BSTEII site of the DSTEQ12 Sindbis virus vector (Joe et al., 1996) downstream of a double subgenomic Sindbis viral promoter. The coding regions of DN cdk2, 3, 4, and 6 (van den Heuvel and Harlow, 1993) and the single chain ScFv control (R6) cDNA was inserted into the XbaI site of the DSTEQ12 vector. The putative DN forms of the CDKs have been previously reported as inactivating Asp to Asn point mutations in the kinase domain (van den Heuvel and Harlow, 1993). The CAT recombinant viruses were generated previously (Cheng et al., 1996 Levine et al., 1996). FLAG tags (ATGGACTACAAGGACGATGATGACAAA) were introduced at the 3′ end of the coding region of p27, p16, DN Cdk2, DN Cdk3, DN Cdk4, and DN Cdk6. Control non-expressing vectors of the CDK inhibitors were generated by eliminating the initiating codon of each inhibitor and in the case of p16, p21, Cdk3, Cdk4, and Cdk6, introducing a premature stop codon shortly after the second methionine in each coding region (Park et al., 1997b ). All mutations, deletions, and FLAG tags were introduced by PCR and confirmed by sequencing. Viral particles were generated by in vitro translation and transfection into BHK cells and titered by plaque assay as previously described (Joe et al., 1996).

Culture and Survival Assay of Rat Sympathetic Neurons

Primary cultures of rat sympathetic neurons were obtained from dissociated superior cervical ganglia of postnatal day 1 rats (strain Harlan Sprague Dawley Inc., Indianapolis, IN) as described previously (Park et al., 1996b ). The cells were plated in 0.5 ml of medium per well in collagen-coated 24-well dishes at a density of 𢏀.5 ganglia/well (�,000 neurons/well). The growth medium was RPMI 1640 medium supplemented with 10% heat-inactivated horse serum (JRH Biosciences, Lenexa, KS) and 60 ng/ml mouse NGF (Sigma Chemical Co., St. Louis, MO). To eliminate non-neuronal cells, a mixture of uridine and 5-fluorodeoxyuridine (10 μM each) were added to the cultures on the following day. 3 d after plating, the neurons were infected with Sindbis virus (plaque-forming units per cell of 1 to 2) in 0.2 ml of RPMI 1640 media containing 2% heat-inactivated horse serum. After 1 h of infection, 0.3 ml of RPMI 1640 medium containing 16% heat-inactivated horse serum was added. The cultures were then treated immediately with 100 μM AraC or left to incubate overnight before UV irradiation (300 J/m 2 ). To achieve the latter, each well containing 200 μl of medium containing NGF was exposed in a Stratolinker (Stratagene, La Jolla, CA). After irradiation, 300 μl of additional medium containing NGF with or without drug was added to each well. At appropriate times, the numbers of viable, phase bright neurons were determined by strip counting as previously described (Rydel and Greene, 1988).

Culture and Survival of Cortical Neurons

Rat cortical neurons were cultured from embryonic day 18 rats as previously described (Friedman et al., 1993). The neurons were plated into 24-well dishes (�,000 cells/well) coated with polylysine in serum-free medium (N2/MEM [1:1] supplemented with 6 mg/ml d -glucose, 100 μg/ml transferrin, 25 μg/ml insulin, 20 nM progesterone, 60 μM putrescine, 30 nM selenium). 1 d after plating, the neurons were infected with virus at a multiplicity of infection of 𢏀.5 and incubated overnight. The medium was then exchanged with serum-free medium supplemented with 10 μM camptothecin where appropriate. At appropriate times of culture under the conditions described in the text, cells were lysed and the numbers of viable cells were evaluated as previously described (Rukenstein et al., 1991). All experimental points are expressed as a percentage of cells plated on day 0 and are reported as mean ± SEM (n = 3).

Imunofluoresensi

Sympathetic neurons or cortical neurons were dissociated and cultured, as described above, in 6-well plates at a density of 2 ganglion/well (sympathetic neurons) or 200,000 cells/well (cortical neurons). After various times of infection, neurons were fixed with 100% ethanol for 20 min at �ଌ, blocked with PBS containing 2% horse serum, and incubated with anti-FLAG primary antibody (cat No. IBI3010 [1:20 dilution] Fisher Scientific Co., Pittsburgh, PA) and FITC-conjugated horse anti–mouse secondary antibody (1:50 dilution Vector Labs, Inc., Burlingame, CA).

Western Blot Analyses

Cortical neurons were dissociated and cultured as described above. 24 h after infection, the neurons were harvested in Laemmli buffer and 50 μg of protein were loaded onto SDS–polyacrylamide gels, and then transferred onto nitrocellulose membrane as previously described (Cunningham et al., 1997). Blots were probed with anti-FLAG antibody (10 μg/ml).

Cyclin D1𠄺ssociated Kinase Assay

D1-associated kinase activity was performed as previously described (Matsushime et al., 1994). In brief, cortical neurons were treated for various times with camptothecin (10 μM). The cells were washed twice with cold PBS and harvested in IP buffer as previously described (Matsushime et al., 1994). Cell lysates were then precleared by incubation with 75 μl protein G𠄺garose beads (Sigma Chemical Co.) for 1 h. 1 μg of anticyclin D1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was then added to 300 μg of cell lysate and incubated for 3 h. As control, lysate containing no antibody was used. 50 μl of protein G beads were then added to the lysates and incubated for 1 h. Washing and kinase assay was performed as previously described (Matsushime et al., 1994). pRb (1 μg Santa Cruz Biotechnology) was used as substrate. pRb was then resolved on a 10% SDS–polyacrylamide gel and incorporation of P 32 was analyzed by autoradiography and densitometry.


Perbincangan

In summary, CDK9 along with cyclin T1 (constituting the P-TEFb complex) plays a key role in transcription by allowing RNAPII to facilitate the productive elongation of transcripts. Its roles extend beyond transcriptional elongation with functions in the cell cycle, differentiation, DNA repair, and transcriptional initiation and termination. Detailed structural characterization has revealed a conserved cyclin-dependent phosphor-transfer mechanism across CDKs, with some subtle differences in substrate recognition and cyclin binding for CDK9. P-TEFb activity is regulated by sequestering into an inactive complex and various post-translational modifications. Given its pivotal functions, when CDK9 becomes overactive in many hematological and solid cancers there is a continuous production of short-lived proteins that maintain the survival of cancer cells. This addiction to transcription makes cancer cells highly susceptible to the inhibition of CDK9 relative to non-transformed cells. Understanding the biology and function of CDK9 has advanced dramatically since its discovery in 1994 (13) and this has had a positive impact on the design and the use of specific inhibitors as a potential strategy for the treatment of several diseases. In line with this, several first generation CDK9 inhibitors have been developed and tested in clinical trials mostly in combination with conventional chemotherapeutic agents. Unfortunately, these investigational new drug entities have been hampered by severe adverse effects and to date none of them have made it to clinical approval (Supplementary Table 1).

Nevertheless, the authors predict that future development will be guided by insights into the molecular structure and function of CDK9, which will serve as the driving force for further improvements in the potency and specificity of novel inhibitors. Meanwhile, a more advanced understanding of its biology is likely to pave the way for establishing a sounder basis for the future value of CDK9 inhibitors for cancer therapy. One missing piece of knowledge in the CDK9 puzzle is a full validation of this target for cancer treatment. Percubaan dalam vivo validation would be best assessed with CDK9-deficient mice. Unfortunately, knockout of CDK9 or its binding partner cyclin T2, is embryonically fatal to the mouse (245, 246). Designs for future studies might use conditional genetic knockout of the CDK9 or cyclin T1/2 genes in various established cancer models to provide more information about the role of the P-TEFb complex in tumor formation. The use of specific inhibitors of CDK9 as chemical probes may well be applied to finally confirm the outcomes from these sophisticated models. To this end, new hope has arisen in recent years from second generation inhibitors, with their much-improved specificity for CDK9 inhibition (Supplementary Table 1). Overall, a holistic understanding of the underlying CDK9 biology will be a prerequisite to optimizing the use of novel kinase inhibitors as mono and/or adjuvant therapies for the future treatment of various neoplastic disorders.


Tonton videonya: DNA gewinnen, vervielfältigen, sichtbar machen (Disember 2022).